Gene detail

Detail information of GWHGAAZE020205

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004252070.1	6.51162E-73	PREDICTED: serine/threonine-protein kinase At5g01020-like [Solanum lycopersicum]
COG	YP_003831303.1	5E-15	PASTA domain-containing Ser/Thr protein kinase
Swissprot	tr\|P46573\|APK1B_ARATH	6E-68	Protein kinase APK1B, chloroplastic (Precursor)
trEMBL	tr\|K4DC19\|K4DC19_SOLLC	2E-73	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc12g009310.1.1}
TAIR10	AT2G28930.2	1E-56	protein kinase 1B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	80197716	80200973	+
GWHAAZE00000005	mRNA	80197716	80200973	+
GWHAAZE00000005	exon	80197716	80197817	+
GWHAAZE00000005	exon	80198225	80198348	+
GWHAAZE00000005	exon	80200669	80200973	+
GWHAAZE00000005	CDS	80197716	80197817	+
GWHAAZE00000005	CDS	80198225	80198348	+
GWHAAZE00000005	CDS	80200669	80200973	+

Transcript Sequence
>GWHTAAZE020227 ATGAAGATTGCTTTGGATGCTGCGAAAGGGCTTGCTTGTCTTCATGATAACGAAAAACTCCTTTATCGGGATTTCAAGACCTCAAATATCTTGTTGGATGAGGATTTTAATGCAAAGATTTCCGATTTTGGACTCGTTAAGAATGCACCTGTGGGAGATCAAACTCATGTATCAACACGTGTTATGGGCACTTACGGATACGCATCTCCTGAGTATATAAGTACTGGTCATTTAACGGCAAAAAATGATGTATATGCATTTGGGGTGGTGCTACTCGAATTGTTGACCGGGAGGGCCGCCATCGACAGGAACAGGTCACCCATGGAGGAAAAGTTGGTCGATTTTGCGCTTCCTCGACTAGTTGGCTACAAGAAACTCCGGCCAATATTAGACCCACGATTAAAAGGCCAATATCATCAAAAAGATATCGGACCTGTGGTGATTCTTGCGCTCAAATGCCTAAGCAATGAAGCAAGAGATAGGCCAGTTATGAAGGAGGTTGTTCATATACTAGAAGCTGCGAAACCTTGA

Network for GWHGAAZE020205

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	3	169	1.70E-25

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.225
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.136
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.078
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.643
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	5.560
	SRR8316896	Juvenile bud stage	15.338
	SRR8316897	Juvenile bud stage	9.327
	SRR8316894	Third green stage	2.696
	SRR8316900	Third green stage	0.500
	SRR8316901	Third green stage	1.729
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.339
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.116
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.415
	SRR6706287	Light intensity 50%	0.304
	SRR6706288	Light intensity 20%	0.253
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.760
	CNS0095593	Slightly white alabastrum(diploid) 2	3.548
	CNS0095594	Slightly white alabastrum(diploid) 3	13.897
	CNS0095595	Whole white alabastrum(diploid) 2	1.224
	CNS0095596	Whole white alabastrum(diploid) 3	0.735
	CNS0095597	Whole white alabastrum(diploid) 4	0.617
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.428
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	24.360
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.196
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.564
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.966
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.978
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.022
	CNS0095610	Silvery flower (tetraploid) 1	0.102
	CNS0095611	Silvery flower (tetraploid) 2	0.073
	CNS0095612	Silvery flower (tetraploid) 3	0.388
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.084
	CNS0095615	Golden flower (tetraploid) 3	0.106
CRA001975	CRR073297	Stem 1	3.489
	CRR073298	Stem 2	1.795
	CRR073299	Stem 3	0.854
	CRR073300	Leaf 1	0.671
	CRR073301	Leaf 2	0.370
	CRR073302	Leaf 3	0.304
	CRR073303	Juvenile bud 1	0.745
	CRR073304	Juvenile bud 2	0.114
	CRR073305	Juvenile bud 3	0.084
	CRR073306	Third green 1	0.257
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.028
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.064
	CRR073319	Tawny withering 2	0.495
	CRR073320	Tawny withering 3	0.257