Gene detail

Detail information of GWHGAAZE020297

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006338109.1	2.71736E-52	PREDICTED: glucan endo-1,3-beta-glucosidase 6-like [Solanum tuberosum]
Swissprot	tr\|Q93Z08\|E136_ARATH	2E-38	Glucan endo-1,3-beta-glucosidase 6 (Precursor)
trEMBL	tr\|K4BZT8\|K4BZT8_SOLLC	1E-52	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc05g025500.2.1}
TAIR10	AT5G58090.1	2E-33	O-Glycosyl hydrolases family 17 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	83300129	83305730	+
GWHAAZE00000005	mRNA	83300129	83305730	+
GWHAAZE00000005	exon	83300129	83300295	+
GWHAAZE00000005	exon	83304912	83304967	+
GWHAAZE00000005	exon	83305492	83305730	+
GWHAAZE00000005	CDS	83300129	83300295	+
GWHAAZE00000005	CDS	83304912	83304967	+
GWHAAZE00000005	CDS	83305492	83305730	+

Transcript Sequence
>GWHTAAZE020319 ATGCAAGATTATGGGGCACTCAAGGCCCTTAGTAAATCTGGGATTGAGGTTATGGTTGGGATTCCCAATGACTTGTTAGCAACTATGGCTTCAAGTATGAAAGCTGCTGAGAAATGGGTTTCCAAGAATGTCTCTGCTCATGTCTCTTCCGATAGTGTCAACATTAGCGTACCGGAAGAGCAGTTCCAAGCTCTATGCCGGTATGAGGATCCTGAAGCTGAAATCAACATTTACCCCTTCATTAGCCTGTACATTGACTCGAGTTTCCCGGTTGAGTATGCCTTTTTTGATGGCAATGCATCTCCTATAAACGATGGTGGCACAAACTATAACAACATGTTTGATGCAAATCATGATACACTTGTTTGGGCTTTGCAGAGAAATGGATTTGGTAACATGCCCATTATAGTCGGTGAGATTGGGTGGCCAACCGATGGGGACCGGAATGCTAACCTCGAGTAA

Network for GWHGAAZE020297

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00332.19	Glyco_hydro_17	75	153	1.40E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19893	GN5_6	Metabolic pathways	map01100
K19893	GN5_6	Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.780
	SRR3591706	second leaf	0.499
	SRR3591707	mature leaf	0.226
	SRR3591708	Shoot apex	0.756
	SRR3591709	Stem	0.177
	SRR3591710	White floral bud	0.125
	SRR3591711	White flower	0.162
	SRR3591712	Green floral bud	0.164
	SRR3591713	Yellow flower	0.026
SRP173429	SRR8316895	Juvenile bud stage	0.898
	SRR8316896	Juvenile bud stage	1.185
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.486
	SRR8316900	Third green stage	2.313
	SRR8316901	Third green stage	1.646
	SRR8316898	Complete white stage	0.187
	SRR8316899	Complete white stage	2.427
	SRR8316903	Complete white stage	0.320
	SRR8316902	Silver flowering stage	0.106
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.002
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.011
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.555
	SRR6706287	Light intensity 50%	2.091
	SRR6706288	Light intensity 20%	1.856
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.714
	CNS0095593	Slightly white alabastrum(diploid) 2	1.720
	CNS0095594	Slightly white alabastrum(diploid) 3	1.044
	CNS0095595	Whole white alabastrum(diploid) 2	1.082
	CNS0095596	Whole white alabastrum(diploid) 3	0.840
	CNS0095597	Whole white alabastrum(diploid) 4	1.093
	CNS0095598	Silvery flower (diploied) 1	1.062
	CNS0095599	Silvery flower (diploied) 2	1.275
	CNS0095600	Silvery flower (diploied) 3	0.632
	CNS0095601	Golden flower (diploid) 1	1.880
	CNS0095602	Golden flower (diploid) 2	0.702
	CNS0095603	Golden flower (diploid) 3	0.492
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.245
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.387
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.329
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.043
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.182
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.258
	CNS0095610	Silvery flower (tetraploid) 1	0.161
	CNS0095611	Silvery flower (tetraploid) 2	0.030
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.020
CRA001975	CRR073297	Stem 1	3.513
	CRR073298	Stem 2	3.769
	CRR073299	Stem 3	3.185
	CRR073300	Leaf 1	2.708
	CRR073301	Leaf 2	3.892
	CRR073302	Leaf 3	3.439
	CRR073303	Juvenile bud 1	2.245
	CRR073304	Juvenile bud 2	1.467
	CRR073305	Juvenile bud 3	2.288
	CRR073306	Third green 1	0.071
	CRR073307	Third green 2	0.087
	CRR073308	Third green 3	0.072
	CRR073309	Second white 1	0.086
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.068
	CRR073315	Gold flowering 1	0.239
	CRR073316	Gold flowering 2	1.834
	CRR073317	Gold flowering 3	0.552
	CRR073318	Tawny withering 1	1.875
	CRR073319	Tawny withering 2	0.769
	CRR073320	Tawny withering 3	0.647