Gene detail

Detail information of GWHGAAZE020478

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP21577.1	4.46917E-29	unnamed protein product [Coffea canephora]
Swissprot	tr\|B9DFG5\|PTI13_ARATH	4E-14	PTI1-like tyrosine-protein kinase 3
trEMBL	tr\|A0A068VLT7\|A0A068VLT7_COFCA	2E-29	Coffea canephora DH200=94 genomic scaffold, scaffold_5000 {ECO:0000313\|EMBL:CDP21577.1}
TAIR10	AT3G59350.3	2E-12	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	6096506	6096932	-
GWHAAZE00000006	mRNA	6096506	6096932	-
GWHAAZE00000006	exon	6096506	6096621	-
GWHAAZE00000006	exon	6096749	6096932	-
GWHAAZE00000006	CDS	6096749	6096932	-
GWHAAZE00000006	CDS	6096506	6096621	-

Transcript Sequence
>GWHTAAZE020500 ATGCAGGCACATGCACCTTCTCCTGGTTACTTTGTACAGCTGGAAAATCAAAGTGCTGAAGACGATCTTTATCTGCGGAAGAAAGCGAGGATGCGGAGGTGGCTGTGCTGTACCTGTCAAGTAGAAGAGTCCTACCCATCGCATGAGAGCGAACTTCTCAAAAGCCCGAGGAACAAAGCAGATGTTTTAGACGGAAAGATACTTTATTATGATATTTTGGATGTTGAATTCACAAGAGATGATAAATTAAAGAGCCGCCCATGCAATGGAAATCATTTAAGAAGAGAGAGGGGAATGTAG

Network for GWHGAAZE020478

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13436	PTI1	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.501
	SRR3591706	second leaf	11.958
	SRR3591707	mature leaf	13.002
	SRR3591708	Shoot apex	13.390
	SRR3591709	Stem	30.907
	SRR3591710	White floral bud	39.799
	SRR3591711	White flower	33.462
	SRR3591712	Green floral bud	24.976
	SRR3591713	Yellow flower	38.007
SRP173429	SRR8316895	Juvenile bud stage	32.283
	SRR8316896	Juvenile bud stage	29.536
	SRR8316897	Juvenile bud stage	17.687
	SRR8316894	Third green stage	11.005
	SRR8316900	Third green stage	30.016
	SRR8316901	Third green stage	25.971
	SRR8316898	Complete white stage	15.487
	SRR8316899	Complete white stage	33.661
	SRR8316903	Complete white stage	30.455
	SRR8316902	Silver flowering stage	20.736
	SRR8316904	Silver flowering stage	29.481
	SRR8316905	Silver flowering stage	16.545
	SRR8316906	Gold flowering stage	53.282
	SRR8316907	Gold flowering stage	55.441
	SRR8316908	Gold flowering stage	57.431
SRP132670	SRR6706286	Control	54.875
	SRR6706287	Light intensity 50%	58.554
	SRR6706288	Light intensity 20%	59.359
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.639
	CNS0095593	Slightly white alabastrum(diploid) 2	14.504
	CNS0095594	Slightly white alabastrum(diploid) 3	21.639
	CNS0095595	Whole white alabastrum(diploid) 2	16.597
	CNS0095596	Whole white alabastrum(diploid) 3	9.495
	CNS0095597	Whole white alabastrum(diploid) 4	13.929
	CNS0095598	Silvery flower (diploied) 1	16.793
	CNS0095599	Silvery flower (diploied) 2	10.004
	CNS0095600	Silvery flower (diploied) 3	34.385
	CNS0095601	Golden flower (diploid) 1	16.825
	CNS0095602	Golden flower (diploid) 2	31.994
	CNS0095603	Golden flower (diploid) 3	37.894
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.224
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.116
	CNS0095606	Slightly white alabastrum(tetraploid) 3	37.112
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.661
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.166
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.655
	CNS0095610	Silvery flower (tetraploid) 1	39.859
	CNS0095611	Silvery flower (tetraploid) 2	37.024
	CNS0095612	Silvery flower (tetraploid) 3	29.766
	CNS0095613	Golden flower (tetraploid) 1	27.158
	CNS0095614	Golden flower (tetraploid) 2	39.316
	CNS0095615	Golden flower (tetraploid) 3	42.040
CRA001975	CRR073297	Stem 1	66.342
	CRR073298	Stem 2	34.553
	CRR073299	Stem 3	43.683
	CRR073300	Leaf 1	43.874
	CRR073301	Leaf 2	40.690
	CRR073302	Leaf 3	32.203
	CRR073303	Juvenile bud 1	40.044
	CRR073304	Juvenile bud 2	46.805
	CRR073305	Juvenile bud 3	63.920
	CRR073306	Third green 1	80.012
	CRR073307	Third green 2	67.251
	CRR073308	Third green 3	61.039
	CRR073309	Second white 1	49.753
	CRR073310	Second white 2	40.377
	CRR073311	Second white 3	48.686
	CRR073312	Silver flowering 1	47.105
	CRR073313	Silver flowering 2	55.669
	CRR073314	Silver flowering 3	26.214
	CRR073315	Gold flowering 1	15.605
	CRR073316	Gold flowering 2	23.216
	CRR073317	Gold flowering 3	18.239
	CRR073318	Tawny withering 1	39.026
	CRR073319	Tawny withering 2	30.724
	CRR073320	Tawny withering 3	31.681