Gene detail

Detail information of GWHGAAZE020517

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO82804.1	3.4946E-154	hypothetical protein CISIN_1g002585mg [Citrus sinensis]
COG	YP_005368730.1	1E-52	glucan 1,4-alpha-maltohexaosidase
Swissprot	tr\|Q94A41\|AMY3_ARATH	1E-148	Alpha-amylase 3, chloroplastic (Precursor)
trEMBL	tr\|A0A067GT62\|A0A067GT62_CITSI	1E-154	Uncharacterized protein {ECO:0000313\|EMBL:KDO82804.1}
TAIR10	AT1G69830.1	1E-122	alpha-amylase-like 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	7469063	7470772	-
GWHAAZE00000006	mRNA	7469063	7470772	-
GWHAAZE00000006	exon	7469063	7469104	-
GWHAAZE00000006	exon	7469634	7469883	-
GWHAAZE00000006	exon	7470063	7470359	-
GWHAAZE00000006	exon	7470567	7470772	-
GWHAAZE00000006	CDS	7470567	7470772	-
GWHAAZE00000006	CDS	7470063	7470359	-
GWHAAZE00000006	CDS	7469634	7469883	-
GWHAAZE00000006	CDS	7469063	7469104	-

Transcript Sequence
>GWHTAAZE020541 ATGTTCAGGAACGGTACAGGTTTTGAAATAGTGTGCCAGGGATTTAATTGGGAGTCTCACAAATCTGGGAGATGGTACATGGAACTCCTAGAAAAAGCTACAGAATTATCTTCACATGGTTTTACTGTTATTTGGTTACCACCACCTATAGAATCTATCTCACCTCAAGGATACATGCCAAAAGATCTATATAATTTAAACTCCAGGTACGGTAGTATTGACGAGTTGAAGGTTCTTGTGAAGAGATTCCATGAAATTGGTATTAAAGTTCTTGGAGATACGGTCTTAAACCACCGCTCTGCACATTATCAGAATCAAAATGGGATTTGGAATATTTGTGGGGGTAAATTAAATTGGGATGATCGAGCAGTTGTTGCTGATGATCCACATTTCCAAGAAGGGGGAAATAAGAGTAGTGGAGAGAATTTCTATGCTGCTCCAAATATTGGTCATTCTCAAGAATTCGTGAGGAATGATCTAAAAGAGTGGTTATGCCGGATGAGGAAAGAAATTGGGTATGATGGATGGAGGATTGATTTTGTTAGGGGATTTTGGGGTGGTTATGTGAAGGACTACATAGATGCAAGTGAGCCATACTTTGCTGTAGGCGAATATTGGGATTCTCTTACTTATAAATATGGTGAGATGGAACACAATCAAGATGCCCATCGGCAGAGAATTGTTGACTGGATTAGTGCTGCCAGTGGAACTGCTGGTGCATTTGATATCACTACAAAAGGAATTCTTCATGCTGTGGCGTTGGCTGGTGGCCATCTCGGGCTGTTACCTTCATAG

Network for GWHGAAZE020517

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00128.25	Alpha-amylase	38	206	1.20E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01176	AMY, amyA, malS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500
		Pancreatic secretion	map04972
		Carbohydrate digestion and absorption	map04973

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.135
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.100
	SRR3591708	Shoot apex	0.493
	SRR3591709	Stem	0.104
	SRR3591710	White floral bud	0.209
	SRR3591711	White flower	0.470
	SRR3591712	Green floral bud	0.170
	SRR3591713	Yellow flower	0.565
SRP173429	SRR8316895	Juvenile bud stage	0.046
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.040
	SRR8316894	Third green stage	0.034
	SRR8316900	Third green stage	0.166
	SRR8316901	Third green stage	0.085
	SRR8316898	Complete white stage	0.054
	SRR8316899	Complete white stage	0.213
	SRR8316903	Complete white stage	0.150
	SRR8316902	Silver flowering stage	0.083
	SRR8316904	Silver flowering stage	0.179
	SRR8316905	Silver flowering stage	0.170
	SRR8316906	Gold flowering stage	0.393
	SRR8316907	Gold flowering stage	0.091
	SRR8316908	Gold flowering stage	0.388
SRP132670	SRR6706286	Control	0.001
	SRR6706287	Light intensity 50%	0.016
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.069
	CNS0095593	Slightly white alabastrum(diploid) 2	0.026
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.053
	CNS0095600	Silvery flower (diploied) 3	0.065
	CNS0095601	Golden flower (diploid) 1	0.058
	CNS0095602	Golden flower (diploid) 2	0.344
	CNS0095603	Golden flower (diploid) 3	0.062
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.375
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.348
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.220
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.395
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.178
	CNS0095610	Silvery flower (tetraploid) 1	0.048
	CNS0095611	Silvery flower (tetraploid) 2	0.261
	CNS0095612	Silvery flower (tetraploid) 3	0.065
	CNS0095613	Golden flower (tetraploid) 1	0.110
	CNS0095614	Golden flower (tetraploid) 2	0.218
	CNS0095615	Golden flower (tetraploid) 3	0.225
CRA001975	CRR073297	Stem 1	0.069
	CRR073298	Stem 2	0.038
	CRR073299	Stem 3	0.047
	CRR073300	Leaf 1	0.176
	CRR073301	Leaf 2	0.064
	CRR073302	Leaf 3	0.195
	CRR073303	Juvenile bud 1	0.068
	CRR073304	Juvenile bud 2	0.141
	CRR073305	Juvenile bud 3	0.166
	CRR073306	Third green 1	0.122
	CRR073307	Third green 2	0.050
	CRR073308	Third green 3	0.075
	CRR073309	Second white 1	0.015
	CRR073310	Second white 2	0.144
	CRR073311	Second white 3	0.008
	CRR073312	Silver flowering 1	0.041
	CRR073313	Silver flowering 2	0.067
	CRR073314	Silver flowering 3	0.135
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.166
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.036