Gene detail

Detail information of GWHGAAZE020523

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002268700.1	5.2603E-124	PREDICTED: B-box zinc finger protein 25 [Vitis vinifera]
Swissprot	tr\|Q9SID1\|BBX25_ARATH	6E-94	B-box zinc finger protein 25 {ECO:0000303\|PubMed:19920209}
trEMBL	tr\|D7U1S6\|D7U1S6_VITVI	2E-124	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI36692.3}
TAIR10	AT2G31380.1	4E-71	salt tolerance homologue

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	7702272	7705132	-
GWHAAZE00000006	mRNA	7702272	7705132	-
GWHAAZE00000006	exon	7702272	7702502	-
GWHAAZE00000006	exon	7703483	7703812	-
GWHAAZE00000006	exon	7704950	7705132	-
GWHAAZE00000006	CDS	7704950	7705132	-
GWHAAZE00000006	CDS	7703483	7703812	-
GWHAAZE00000006	CDS	7702272	7702502	-

Transcript Sequence
>GWHTAAZE020547 ATGAAGATTCAATGTGATGTATGTGAGAAAGCTCCGGCGACTGTGATTTGTTGTGCTGATGAAGCAGCTTTGTGCTCAAAATGTGACACTGAAGTACATGCTGCAAATAAGCTTGCAAGCAAGCACCAGAGGCTTGTTCTGCAATCTCTCTCCAATAAGCTTCCTCCTTGTGACATATGCCAAGAGAAAGCGGCTTTCATTTTCTGCGTTGAAGACCGAGCTCTCTTCTGCCGCGATTGTGATCAGCCCATTCATTCATCCGGTAGTCTTGCTGCCAACCACCAGCGGTTTCTAGCCACCGGAATCCGAGTAGCTTTGAATTCAAATCCGCCCCAGGAGGCTGAGAACCACGACCTAAATCCACCTGCACCACCACCATCACCACCACCACTGAACAAGAGTCCCCAAAATATTCCCCTGAAAACACCCACACAGCAAAATTCTGGTTTCAGTTCTCCTTCATGGGCCGTAGATGACTTGTTACAGTTCTCCGATTTTGAATCTTCTGACAAGAAAGAGCAACTAGAGTTCGGAGAGCTTGATTGGTTGACAGAGATCGGTATGTTTGGTGATCAAGTTGCTCAAGAGACCTTAGCAGCAGCCGAAGTTCCTCAGCTTCAAGTATCATCACAGTCGAGCCCTATAACCTCATATAGACCAAACAAAAACTACATGCCTAACAAGAAACCTAGGATTGAAATCTCGGAGGATGATGATGATCATTTTACTGTTCCGGATTTCACT

Network for GWHGAAZE020523

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00643.25	zf-B_box	3	44	4.30E-05
PF00643.25	zf-B_box	53	95	3.70E-07

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	DBB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	102.077
	SRR3591706	second leaf	139.758
	SRR3591707	mature leaf	213.598
	SRR3591708	Shoot apex	87.149
	SRR3591709	Stem	88.723
	SRR3591710	White floral bud	36.250
	SRR3591711	White flower	46.164
	SRR3591712	Green floral bud	42.008
	SRR3591713	Yellow flower	30.304
SRP173429	SRR8316895	Juvenile bud stage	60.628
	SRR8316896	Juvenile bud stage	60.937
	SRR8316897	Juvenile bud stage	44.775
	SRR8316894	Third green stage	26.149
	SRR8316900	Third green stage	83.211
	SRR8316901	Third green stage	78.160
	SRR8316898	Complete white stage	15.745
	SRR8316899	Complete white stage	105.077
	SRR8316903	Complete white stage	33.298
	SRR8316902	Silver flowering stage	21.400
	SRR8316904	Silver flowering stage	24.678
	SRR8316905	Silver flowering stage	15.484
	SRR8316906	Gold flowering stage	45.146
	SRR8316907	Gold flowering stage	40.241
	SRR8316908	Gold flowering stage	56.195
SRP132670	SRR6706286	Control	109.671
	SRR6706287	Light intensity 50%	93.465
	SRR6706288	Light intensity 20%	92.594
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	44.553
	CNS0095593	Slightly white alabastrum(diploid) 2	47.104
	CNS0095594	Slightly white alabastrum(diploid) 3	37.627
	CNS0095595	Whole white alabastrum(diploid) 2	30.472
	CNS0095596	Whole white alabastrum(diploid) 3	25.252
	CNS0095597	Whole white alabastrum(diploid) 4	28.094
	CNS0095598	Silvery flower (diploied) 1	60.156
	CNS0095599	Silvery flower (diploied) 2	56.067
	CNS0095600	Silvery flower (diploied) 3	64.303
	CNS0095601	Golden flower (diploid) 1	64.542
	CNS0095602	Golden flower (diploid) 2	77.784
	CNS0095603	Golden flower (diploid) 3	69.951
	CNS0095604	Slightly white alabastrum(tetraploid) 1	58.933
	CNS0095605	Slightly white alabastrum(tetraploid) 2	47.530
	CNS0095606	Slightly white alabastrum(tetraploid) 3	118.491
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.941
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.721
	CNS0095609	Whole white alabastrum(tetraploid) 3	67.467
	CNS0095610	Silvery flower (tetraploid) 1	56.592
	CNS0095611	Silvery flower (tetraploid) 2	67.497
	CNS0095612	Silvery flower (tetraploid) 3	8.987
	CNS0095613	Golden flower (tetraploid) 1	26.839
	CNS0095614	Golden flower (tetraploid) 2	56.333
	CNS0095615	Golden flower (tetraploid) 3	44.391
CRA001975	CRR073297	Stem 1	36.107
	CRR073298	Stem 2	39.695
	CRR073299	Stem 3	45.173
	CRR073300	Leaf 1	41.443
	CRR073301	Leaf 2	57.182
	CRR073302	Leaf 3	48.428
	CRR073303	Juvenile bud 1	55.005
	CRR073304	Juvenile bud 2	46.559
	CRR073305	Juvenile bud 3	57.692
	CRR073306	Third green 1	83.992
	CRR073307	Third green 2	70.426
	CRR073308	Third green 3	62.170
	CRR073309	Second white 1	27.635
	CRR073310	Second white 2	13.203
	CRR073311	Second white 3	12.404
	CRR073312	Silver flowering 1	10.252
	CRR073313	Silver flowering 2	10.377
	CRR073314	Silver flowering 3	11.172
	CRR073315	Gold flowering 1	108.748
	CRR073316	Gold flowering 2	96.990
	CRR073317	Gold flowering 3	101.396
	CRR073318	Tawny withering 1	28.832
	CRR073319	Tawny withering 2	28.954
	CRR073320	Tawny withering 3	19.469