Gene detail

Detail information of GWHGAAZE020597

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007011293.1	3.67455E-33	Cytochrome p450 79a2 [Theobroma cacao]
COG	YP_003951661.1	0.0000001	cytochrome p450 superfamily
Swissprot	tr\|Q9M7B8\|C79D1_MANES	2E-31	Valine N-monooxygenase 1
trEMBL	tr\|A0A061FT21\|A0A061FT21_THECC	1E-33	Cytochrome p450 79a2 {ECO:0000313\|EMBL:EOY20103.1}
TAIR10	AT5G05260.1	1E-23	cytochrome p450 79a2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	12034052	12034306	+
GWHAAZE00000006	mRNA	12034052	12034306	+
GWHAAZE00000006	exon	12034052	12034306	+
GWHAAZE00000006	CDS	12034052	12034306	+

Transcript Sequence
>GWHTAAZE020621 ATAAATAAAGGGCAGCCATGTGCTTTAAGTCGACTCGGTCTTGGCCGTGATCCAAGAATCTGGGATGACCCACTGACCTTTAATCCAGAGCGACACCTGAGGGACAATAGCACTGAAGTGGCACTAACAGAGTCAGAGTTTCAACTTTTGTCTTTTAGTAGTGGGCGAAGAGGATGCTTAGGAGTTCTCTTGGGTTCGACAATGACAATAATGCTGCTAGCAAGGCTTCTTCAATGCTTCACTTGGAGTGCTCCA

Network for GWHGAAZE020597

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	1	84	4.70E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12153	CYP79A2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Cyanoamino acid metabolism	map00460
		Glucosinolate biosynthesis	map00966

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0005506	molecular_function	iron ion binding
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.245
	SRR8316896	Juvenile bud stage	0.005
	SRR8316897	Juvenile bud stage	0.014
	SRR8316894	Third green stage	0.257
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.359
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.020
	SRR8316902	Silver flowering stage	0.115
	SRR8316904	Silver flowering stage	2.175
	SRR8316905	Silver flowering stage	0.705
	SRR8316906	Gold flowering stage	0.099
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.174
SRP132670	SRR6706286	Control	0.005
	SRR6706287	Light intensity 50%	0.002
	SRR6706288	Light intensity 20%	0.005
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.004
	CNS0095593	Slightly white alabastrum(diploid) 2	0.007
	CNS0095594	Slightly white alabastrum(diploid) 3	0.005
	CNS0095595	Whole white alabastrum(diploid) 2	0.004
	CNS0095596	Whole white alabastrum(diploid) 3	0.009
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.006
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.045
	CNS0095602	Golden flower (diploid) 2	0.024
	CNS0095603	Golden flower (diploid) 3	0.027
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.009
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.016
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.002
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.030
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.001
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.011
	CNS0095610	Silvery flower (tetraploid) 1	0.013
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	5.842
	CNS0095613	Golden flower (tetraploid) 1	0.063
	CNS0095614	Golden flower (tetraploid) 2	0.096
	CNS0095615	Golden flower (tetraploid) 3	0.030
CRA001975	CRR073297	Stem 1	0.021
	CRR073298	Stem 2	0.115
	CRR073299	Stem 3	0.013
	CRR073300	Leaf 1	0.013
	CRR073301	Leaf 2	0.013
	CRR073302	Leaf 3	0.013
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.023
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	1.175
	CRR073307	Third green 2	1.470
	CRR073308	Third green 3	4.307
	CRR073309	Second white 1	4.647
	CRR073310	Second white 2	2.449
	CRR073311	Second white 3	2.429
	CRR073312	Silver flowering 1	8.986
	CRR073313	Silver flowering 2	11.237
	CRR073314	Silver flowering 3	0.806
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.013
	CRR073318	Tawny withering 1	0.047
	CRR073319	Tawny withering 2	0.022
	CRR073320	Tawny withering 3	0.014