Gene detail

Detail information of GWHGAAZE020622

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009616200.1	3.49447E-62	PREDICTED: DNA-directed RNA polymerases II and V subunit 8A-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9M1A8\|RPB8B_ARATH	1E-49	DNA-directed RNA polymerases II, IV and V subunit 8B
trEMBL	tr\|D7T2A9\|D7T2A9_VITVI	6E-61	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI24640.3}
TAIR10	AT3G59600.1	8E-40	RNA polymerase Rpb8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	12921140	12924401	+
GWHAAZE00000006	mRNA	12921140	12924401	+
GWHAAZE00000006	exon	12921140	12921322	+
GWHAAZE00000006	exon	12922461	12922555	+
GWHAAZE00000006	exon	12924290	12924401	+
GWHAAZE00000006	CDS	12921140	12921322	+
GWHAAZE00000006	CDS	12922461	12922555	+
GWHAAZE00000006	CDS	12924290	12924401	+

Transcript Sequence
>GWHTAAZE020646 ATGCCCATAATGGGTTTTTTTGAAGTTACTCGAATAGAAGCACGGAGCGAGCAGTTTGACATGTACGTGCAGCTAGATGTGAATTCAGAGATATATCCTATGCGTACTGGAGAGAAATTCATGATGGTACTTGCCTCTACCATAAACTTGGATGGAACACCCGACACTGGTTATTTTACTCAGGGTCCACGAAAGTCGCTTGCAGACAAGTTCGAATATGTGATGCAGGGGAAATTATTTAAGTTCTTTGATGAAGGCAGTGGGCCTAATGTTAAATCGGTCTTTCTAGTATCGTTTGGTGGACTACTGATGATGATGAAGGGGGACCCTTCCATTGCGGCTAAGTTCGAGCTTGATCAGAGGTTGTTTATCCTCATGAGGAAGGTTTAA

Network for GWHGAAZE020622

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0258

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03870.16	RNA_pol_Rpb8	6	128	8.70E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03016	RPB8, POLR2H	RNA polymerase	map03020
K03016	RPB8, POLR2H	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	85.893
	SRR3591706	second leaf	51.930
	SRR3591707	mature leaf	43.985
	SRR3591708	Shoot apex	75.689
	SRR3591709	Stem	84.716
	SRR3591710	White floral bud	48.784
	SRR3591711	White flower	72.744
	SRR3591712	Green floral bud	63.786
	SRR3591713	Yellow flower	65.414
SRP173429	SRR8316895	Juvenile bud stage	64.602
	SRR8316896	Juvenile bud stage	87.259
	SRR8316897	Juvenile bud stage	38.345
	SRR8316894	Third green stage	27.554
	SRR8316900	Third green stage	96.635
	SRR8316901	Third green stage	96.643
	SRR8316898	Complete white stage	46.792
	SRR8316899	Complete white stage	148.205
	SRR8316903	Complete white stage	61.598
	SRR8316902	Silver flowering stage	43.789
	SRR8316904	Silver flowering stage	48.730
	SRR8316905	Silver flowering stage	20.892
	SRR8316906	Gold flowering stage	78.804
	SRR8316907	Gold flowering stage	99.434
	SRR8316908	Gold flowering stage	53.810
SRP132670	SRR6706286	Control	50.930
	SRR6706287	Light intensity 50%	57.343
	SRR6706288	Light intensity 20%	62.501
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	78.232
	CNS0095593	Slightly white alabastrum(diploid) 2	79.042
	CNS0095594	Slightly white alabastrum(diploid) 3	92.875
	CNS0095595	Whole white alabastrum(diploid) 2	83.938
	CNS0095596	Whole white alabastrum(diploid) 3	83.339
	CNS0095597	Whole white alabastrum(diploid) 4	74.688
	CNS0095598	Silvery flower (diploied) 1	104.994
	CNS0095599	Silvery flower (diploied) 2	85.430
	CNS0095600	Silvery flower (diploied) 3	100.944
	CNS0095601	Golden flower (diploid) 1	94.067
	CNS0095602	Golden flower (diploid) 2	94.742
	CNS0095603	Golden flower (diploid) 3	93.869
	CNS0095604	Slightly white alabastrum(tetraploid) 1	87.968
	CNS0095605	Slightly white alabastrum(tetraploid) 2	82.900
	CNS0095606	Slightly white alabastrum(tetraploid) 3	70.262
	CNS0095607	Whole white alabastrum(tetraploid) 1	60.109
	CNS0095608	Whole white alabastrum(tetraploid) 2	54.175
	CNS0095609	Whole white alabastrum(tetraploid) 3	65.230
	CNS0095610	Silvery flower (tetraploid) 1	61.017
	CNS0095611	Silvery flower (tetraploid) 2	71.660
	CNS0095612	Silvery flower (tetraploid) 3	50.141
	CNS0095613	Golden flower (tetraploid) 1	36.616
	CNS0095614	Golden flower (tetraploid) 2	53.786
	CNS0095615	Golden flower (tetraploid) 3	33.684
CRA001975	CRR073297	Stem 1	41.890
	CRR073298	Stem 2	37.840
	CRR073299	Stem 3	36.835
	CRR073300	Leaf 1	29.086
	CRR073301	Leaf 2	28.249
	CRR073302	Leaf 3	25.575
	CRR073303	Juvenile bud 1	38.848
	CRR073304	Juvenile bud 2	39.518
	CRR073305	Juvenile bud 3	29.538
	CRR073306	Third green 1	15.989
	CRR073307	Third green 2	15.154
	CRR073308	Third green 3	16.007
	CRR073309	Second white 1	25.064
	CRR073310	Second white 2	27.046
	CRR073311	Second white 3	18.538
	CRR073312	Silver flowering 1	11.214
	CRR073313	Silver flowering 2	8.801
	CRR073314	Silver flowering 3	12.277
	CRR073315	Gold flowering 1	28.658
	CRR073316	Gold flowering 2	36.624
	CRR073317	Gold flowering 3	23.405
	CRR073318	Tawny withering 1	47.528
	CRR073319	Tawny withering 2	62.184
	CRR073320	Tawny withering 3	44.233