Gene detail

Detail information of GWHGAAZE020784

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EAY93821.1	1.37229E-45	hypothetical protein OsI_15600 [Oryza sativa Indica Group]
Swissprot	tr\|Q40731\|STAD5_ORYSJ	4E-46	Acyl-[acyl-carrier-protein] desaturase 5, chloroplastic (Precursor)
trEMBL	tr\|A2XSL1\|A2XSL1_ORYSI	5E-46	Acyl-[acyl-carrier-protein] desaturase {ECO:0000256\|RuleBase:RU000582}
TAIR10	AT5G16240.1	1E-35	Plant stearoyl-acyl-carrier-protein desaturase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	20982329	20982784	-
GWHAAZE00000006	mRNA	20982329	20982784	-
GWHAAZE00000006	exon	20982329	20982784	-
GWHAAZE00000006	CDS	20982329	20982784	-

Transcript Sequence
>GWHTAAZE020808 ATGTGGTACAATAGCATGACGAGAAACGCCATGAGACCGCGCGACACCAAAATAGTGGAAAAGCTATTTGAGATCGACCCAAATGATACAGTCCTTGCTTTTGAAGACATGATGAGGAAAAAAATCTCAATGCCGGCCCACTTAATGTTTGATGGTCGTGATGACAACCTTTTCGAGCACTTCTCAGCTGTGGCTCAGCGCCTTGGGGTCTACACTGCAAGGGACTATGCAGATATATTGGAGCATTTGGTTAAAAGGTGGAACATAGCAGATCTAACTGGCCTTTCGGTAAAGGGCAAGCTGCTCAACACTATGTTTGTGAGTTACCTTCTAAAATTAGAAGGATCGAGGAGAGAGCTCGAGCGAGGGCGAAAGAGGGACCCGCAGTTCCATTTAGCTGGGTCTCTGATAGAAAAGTTCAGATTTGAGGGCTTGATGAAGAATTCATTTAGTTGA

Network for GWHGAAZE020784

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03405.15	FA_desaturase_2	16	128	4.00E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03921	FAB2, SSI2, desA1	Metabolic pathways	map01100
		Fatty acid metabolism	map01212
		Fatty acid biosynthesis	map00061
		Biosynthesis of unsaturated fatty acids	map01040

Gene Ontology

GO term	Ontology	Name
GO:0006633	biological_process	fatty acid biosynthetic process
GO:0055114	biological_process	oxidation-reduction process
GO:0006631	biological_process	fatty acid metabolic process
GO:0016491	molecular_function	oxidoreductase activity
GO:0045300	molecular_function	acyl-[acyl-carrier-protein] desaturase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.899
	SRR3591706	second leaf	17.567
	SRR3591707	mature leaf	5.970
	SRR3591708	Shoot apex	33.987
	SRR3591709	Stem	5.892
	SRR3591710	White floral bud	6.069
	SRR3591711	White flower	3.815
	SRR3591712	Green floral bud	6.300
	SRR3591713	Yellow flower	0.557
SRP173429	SRR8316895	Juvenile bud stage	6.086
	SRR8316896	Juvenile bud stage	8.073
	SRR8316897	Juvenile bud stage	2.716
	SRR8316894	Third green stage	3.105
	SRR8316900	Third green stage	5.830
	SRR8316901	Third green stage	5.849
	SRR8316898	Complete white stage	0.949
	SRR8316899	Complete white stage	5.891
	SRR8316903	Complete white stage	1.609
	SRR8316902	Silver flowering stage	1.545
	SRR8316904	Silver flowering stage	1.116
	SRR8316905	Silver flowering stage	1.297
	SRR8316906	Gold flowering stage	0.814
	SRR8316907	Gold flowering stage	0.554
	SRR8316908	Gold flowering stage	0.965
SRP132670	SRR6706286	Control	2.943
	SRR6706287	Light intensity 50%	2.198
	SRR6706288	Light intensity 20%	2.392
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.412
	CNS0095593	Slightly white alabastrum(diploid) 2	6.548
	CNS0095594	Slightly white alabastrum(diploid) 3	6.915
	CNS0095595	Whole white alabastrum(diploid) 2	5.773
	CNS0095596	Whole white alabastrum(diploid) 3	5.288
	CNS0095597	Whole white alabastrum(diploid) 4	6.319
	CNS0095598	Silvery flower (diploied) 1	1.866
	CNS0095599	Silvery flower (diploied) 2	2.128
	CNS0095600	Silvery flower (diploied) 3	2.354
	CNS0095601	Golden flower (diploid) 1	2.937
	CNS0095602	Golden flower (diploid) 2	2.995
	CNS0095603	Golden flower (diploid) 3	2.614
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.667
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.642
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.341
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.964
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.318
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.578
	CNS0095610	Silvery flower (tetraploid) 1	0.980
	CNS0095611	Silvery flower (tetraploid) 2	1.643
	CNS0095612	Silvery flower (tetraploid) 3	0.675
	CNS0095613	Golden flower (tetraploid) 1	1.232
	CNS0095614	Golden flower (tetraploid) 2	1.300
	CNS0095615	Golden flower (tetraploid) 3	0.752
CRA001975	CRR073297	Stem 1	8.411
	CRR073298	Stem 2	8.496
	CRR073299	Stem 3	7.951
	CRR073300	Leaf 1	5.108
	CRR073301	Leaf 2	4.917
	CRR073302	Leaf 3	5.862
	CRR073303	Juvenile bud 1	5.289
	CRR073304	Juvenile bud 2	3.623
	CRR073305	Juvenile bud 3	2.957
	CRR073306	Third green 1	1.139
	CRR073307	Third green 2	2.206
	CRR073308	Third green 3	2.001
	CRR073309	Second white 1	0.670
	CRR073310	Second white 2	1.090
	CRR073311	Second white 3	1.184
	CRR073312	Silver flowering 1	2.095
	CRR073313	Silver flowering 2	2.616
	CRR073314	Silver flowering 3	0.739
	CRR073315	Gold flowering 1	6.797
	CRR073316	Gold flowering 2	9.226
	CRR073317	Gold flowering 3	7.243
	CRR073318	Tawny withering 1	13.789
	CRR073319	Tawny withering 2	7.917
	CRR073320	Tawny withering 3	16.221