Gene detail

Detail information of GWHGAAZE020785

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFT92043.1	2.27739E-98	stearoyl-acyl-carrier protein desaturase [Manihot esculenta]
COG	YP_006369323.1	0.0000008	Fatty acid desaturase
Swissprot	tr\|P22337\|STAD_RICCO	3E-99	Acyl-[acyl-carrier-protein] desaturase, chloroplastic (Precursor)
trEMBL	tr\|K0E5T2\|K0E5T2_MANES	8E-99	Acyl-[acyl-carrier-protein] desaturase {ECO:0000256\|RuleBase:RU000582}
TAIR10	AT2G43710.2	8E-78	Plant stearoyl-acyl-carrier-protein desaturase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	20984387	20984863	-
GWHAAZE00000006	mRNA	20984387	20984863	-
GWHAAZE00000006	exon	20984387	20984863	-
GWHAAZE00000006	CDS	20984387	20984863	-

Transcript Sequence
>GWHTAAZE020809 ATGCCATCCCAAAAGATTGAGATCTTCAAATCACTGGAGGATTGGGCCGAACAAAACATACTGGTTCACCTAAAACCCGTAGAGAAGTGCTGGCAACCACAAGATTTTCTTCCCGATCCAACATCGGACGGTTTTGAAGAGCAAGTCAAGGAACTAAGGGAGAGGGCGAAGGAGCTTCCAGATGAGTACTTTGTTGTTTTGGTCGGAGATATGATCACCGAAGAAGCACTTCCAACCTACCAAACAATGCTTAATACTCTTGACGGTGTTCGTGATGAAACGGGGGCCAGCCCTACTAGTTGGGCTGTTTGGACGAGGGCTTGGACAGCTGAAGAAAACAGGCACGGTGATCTTCTCAATAAGTATCTCTACCTTTCTGGACGAGTCGATATGAGGCAAATTGAGAAGACTATTCAGTATCTGGTTGGATCGGGAATGGTGAGATCTTTGCCAATAAATTTCCTATTAGCTGTATGA

Network for GWHGAAZE020785

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03405.15	FA_desaturase_2	5	148	2.80E-71

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03921	FAB2, SSI2, desA1	Metabolic pathways	map01100
		Fatty acid metabolism	map01212
		Fatty acid biosynthesis	map00061
		Biosynthesis of unsaturated fatty acids	map01040

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0006631	biological_process	fatty acid metabolic process
GO:0016491	molecular_function	oxidoreductase activity
GO:0045300	molecular_function	acyl-[acyl-carrier-protein] desaturase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	53.846
	SRR3591706	second leaf	77.682
	SRR3591707	mature leaf	28.462
	SRR3591708	Shoot apex	122.836
	SRR3591709	Stem	18.070
	SRR3591710	White floral bud	23.651
	SRR3591711	White flower	12.533
	SRR3591712	Green floral bud	24.678
	SRR3591713	Yellow flower	6.222
SRP173429	SRR8316895	Juvenile bud stage	36.263
	SRR8316896	Juvenile bud stage	39.829
	SRR8316897	Juvenile bud stage	15.871
	SRR8316894	Third green stage	15.051
	SRR8316900	Third green stage	35.147
	SRR8316901	Third green stage	32.370
	SRR8316898	Complete white stage	6.336
	SRR8316899	Complete white stage	19.503
	SRR8316903	Complete white stage	8.139
	SRR8316902	Silver flowering stage	3.994
	SRR8316904	Silver flowering stage	6.958
	SRR8316905	Silver flowering stage	2.687
	SRR8316906	Gold flowering stage	9.747
	SRR8316907	Gold flowering stage	9.732
	SRR8316908	Gold flowering stage	9.408
SRP132670	SRR6706286	Control	47.452
	SRR6706287	Light intensity 50%	50.387
	SRR6706288	Light intensity 20%	50.885
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	29.447
	CNS0095593	Slightly white alabastrum(diploid) 2	20.186
	CNS0095594	Slightly white alabastrum(diploid) 3	31.409
	CNS0095595	Whole white alabastrum(diploid) 2	30.375
	CNS0095596	Whole white alabastrum(diploid) 3	38.425
	CNS0095597	Whole white alabastrum(diploid) 4	34.298
	CNS0095598	Silvery flower (diploied) 1	25.809
	CNS0095599	Silvery flower (diploied) 2	17.109
	CNS0095600	Silvery flower (diploied) 3	17.469
	CNS0095601	Golden flower (diploid) 1	15.968
	CNS0095602	Golden flower (diploid) 2	22.297
	CNS0095603	Golden flower (diploid) 3	22.470
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.951
	CNS0095605	Slightly white alabastrum(tetraploid) 2	36.679
	CNS0095606	Slightly white alabastrum(tetraploid) 3	31.433
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.618
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.462
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.339
	CNS0095610	Silvery flower (tetraploid) 1	9.332
	CNS0095611	Silvery flower (tetraploid) 2	13.563
	CNS0095612	Silvery flower (tetraploid) 3	13.870
	CNS0095613	Golden flower (tetraploid) 1	5.365
	CNS0095614	Golden flower (tetraploid) 2	9.126
	CNS0095615	Golden flower (tetraploid) 3	8.405
CRA001975	CRR073297	Stem 1	89.880
	CRR073298	Stem 2	78.932
	CRR073299	Stem 3	84.316
	CRR073300	Leaf 1	54.687
	CRR073301	Leaf 2	53.147
	CRR073302	Leaf 3	52.296
	CRR073303	Juvenile bud 1	50.443
	CRR073304	Juvenile bud 2	40.755
	CRR073305	Juvenile bud 3	29.435
	CRR073306	Third green 1	18.526
	CRR073307	Third green 2	18.227
	CRR073308	Third green 3	17.963
	CRR073309	Second white 1	9.347
	CRR073310	Second white 2	7.374
	CRR073311	Second white 3	6.532
	CRR073312	Silver flowering 1	18.021
	CRR073313	Silver flowering 2	25.926
	CRR073314	Silver flowering 3	17.966
	CRR073315	Gold flowering 1	65.183
	CRR073316	Gold flowering 2	83.523
	CRR073317	Gold flowering 3	68.062
	CRR073318	Tawny withering 1	86.177
	CRR073319	Tawny withering 2	38.252
	CRR073320	Tawny withering 3	105.056