Gene detail

Detail information of GWHGAAZE020852

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003631646.1	6.27321E-54	PREDICTED: uncharacterized protein LOC100853221 [Vitis vinifera]
trEMBL	tr\|D7TQ07\|D7TQ07_VITVI	2E-54	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI32580.3}
TAIR10	AT3G18870.1	1E-30	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	23301615	23302064	-
GWHAAZE00000006	mRNA	23301615	23302064	-
GWHAAZE00000006	exon	23301615	23302064	-
GWHAAZE00000006	CDS	23301615	23302064	-

Transcript Sequence
>GWHTAAZE020876 TTCAACATCACTCACTGTGAAAATCTCCGGTACCTGAAAACCCTTGGCGTAAACCACCCCCACACCAAAACCCCCAAATCCTCGGAAACCCTAGCCCATATCCTCTCCACCGTCAATTACCTCAAATTGAAGGGCTTCTCAGACCCCAATTTCTCCAGACCCGCCTTCTTCTGCCCTAATCTCTTCTCCCTTGAATTCAACCCCACTTATCTCGAACCAGTTTTCAATTTCTTAACCTCCGATTCATCTGCATCAGTCAAAGAATTGAGCAGTTTAGTTCTCAAATGTCCTCACATTCTTGAATCAAACGTGGAGTTTTGTTTAAGGCCAACACTAACTTATTTTAAAAAATTAGGGATTGAGAAACTGAACACTCTGACTACTTTAAATTCACATTTGTTGAATACTAGGGTTGATAAATTAAAGGAGAATGTGAGATTCTTGCGGAGT

Network for GWHGAAZE020852

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	38	150	7.00E-07

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.810
	SRR3591706	second leaf	0.725
	SRR3591707	mature leaf	0.600
	SRR3591708	Shoot apex	0.609
	SRR3591709	Stem	0.863
	SRR3591710	White floral bud	0.445
	SRR3591711	White flower	0.301
	SRR3591712	Green floral bud	1.621
	SRR3591713	Yellow flower	0.516
SRP173429	SRR8316895	Juvenile bud stage	1.843
	SRR8316896	Juvenile bud stage	1.818
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.971
	SRR8316900	Third green stage	2.116
	SRR8316901	Third green stage	1.911
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.216
	SRR8316903	Complete white stage	0.995
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.793
	SRR8316905	Silver flowering stage	0.004
	SRR8316906	Gold flowering stage	0.382
	SRR8316907	Gold flowering stage	0.608
	SRR8316908	Gold flowering stage	0.220
SRP132670	SRR6706286	Control	2.637
	SRR6706287	Light intensity 50%	1.850
	SRR6706288	Light intensity 20%	2.290
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.739
	CNS0095593	Slightly white alabastrum(diploid) 2	2.452
	CNS0095594	Slightly white alabastrum(diploid) 3	2.416
	CNS0095595	Whole white alabastrum(diploid) 2	1.710
	CNS0095596	Whole white alabastrum(diploid) 3	0.562
	CNS0095597	Whole white alabastrum(diploid) 4	0.837
	CNS0095598	Silvery flower (diploied) 1	0.156
	CNS0095599	Silvery flower (diploied) 2	0.503
	CNS0095600	Silvery flower (diploied) 3	1.906
	CNS0095601	Golden flower (diploid) 1	0.021
	CNS0095602	Golden flower (diploid) 2	1.078
	CNS0095603	Golden flower (diploid) 3	0.844
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.419
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.633
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.444
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.094
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.113
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.420
	CNS0095610	Silvery flower (tetraploid) 1	0.749
	CNS0095611	Silvery flower (tetraploid) 2	0.533
	CNS0095612	Silvery flower (tetraploid) 3	0.882
	CNS0095613	Golden flower (tetraploid) 1	0.158
	CNS0095614	Golden flower (tetraploid) 2	0.555
	CNS0095615	Golden flower (tetraploid) 3	0.226
CRA001975	CRR073297	Stem 1	3.069
	CRR073298	Stem 2	2.255
	CRR073299	Stem 3	0.247
	CRR073300	Leaf 1	2.880
	CRR073301	Leaf 2	1.419
	CRR073302	Leaf 3	0.062
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.167
	CRR073305	Juvenile bud 3	0.132
	CRR073306	Third green 1	0.067
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.169
	CRR073313	Silver flowering 2	0.119
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	1.632
	CRR073317	Gold flowering 3	0.022
	CRR073318	Tawny withering 1	0.470
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.342