Gene detail

Detail information of GWHGAAZE020918

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFK49116.1	8.73866E-69	unknown [Medicago truncatula]
Swissprot	tr\|Q07176\|MMK1_MEDSA	2E-69	Mitogen-activated protein kinase homolog MMK1
trEMBL	tr\|I3T9C4\|I3T9C4_MEDTR	3E-69	Uncharacterized protein {ECO:0000313\|EMBL:AFK49116.1}
TAIR10	AT2G43790.1	3E-48	MAP kinase 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	26505567	26508772	+
GWHAAZE00000006	mRNA	26505567	26508772	+
GWHAAZE00000006	exon	26505567	26505572	+
GWHAAZE00000006	exon	26505654	26505834	+
GWHAAZE00000006	exon	26508603	26508772	+
GWHAAZE00000006	CDS	26505567	26505572	+
GWHAAZE00000006	CDS	26505654	26505834	+
GWHAAZE00000006	CDS	26508603	26508772	+

Transcript Sequence
>GWHTAAZE020942 ATGAATCTGATTGGCACCCCGTCAGAGGCTGAGTTGGGGTTTTTGAATGAAAATGCGAAGAGATACATTCGGCAACTTCCTCCTTACTTTCGGCAGTCACTTACTGAGAAGTTTCCACACGTTCATCCTGTTGCCATTGACCTCATTGAGAAAATGTTGACATTTGATCCTAGACAGAGGATCACAGTGGAAAATGCACTAGCGCATCCGTACTTGGCGTCGCTCCATGATGAAAGTGACGAGCCAGTTTGCATGACTCCTTTCAACTTCGATTTTGAGCAGCATGCCCTAAGCGAAGAACAGATGAAGGAGCTTATTTACAGAGAGGCTCTCGCTTTTAATCCAGAGTACCACTAA

Network for GWHGAAZE020918

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14512	MPK6	MAPK signaling pathway - plant	map04016
		Plant hormone signal transduction	map04075
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	69.512
	SRR3591706	second leaf	38.144
	SRR3591707	mature leaf	36.586
	SRR3591708	Shoot apex	62.873
	SRR3591709	Stem	74.664
	SRR3591710	White floral bud	51.525
	SRR3591711	White flower	60.746
	SRR3591712	Green floral bud	54.493
	SRR3591713	Yellow flower	65.783
SRP173429	SRR8316895	Juvenile bud stage	33.832
	SRR8316896	Juvenile bud stage	49.971
	SRR8316897	Juvenile bud stage	24.615
	SRR8316894	Third green stage	21.563
	SRR8316900	Third green stage	68.062
	SRR8316901	Third green stage	55.779
	SRR8316898	Complete white stage	36.067
	SRR8316899	Complete white stage	83.427
	SRR8316903	Complete white stage	36.294
	SRR8316902	Silver flowering stage	30.845
	SRR8316904	Silver flowering stage	33.660
	SRR8316905	Silver flowering stage	20.413
	SRR8316906	Gold flowering stage	56.004
	SRR8316907	Gold flowering stage	57.771
	SRR8316908	Gold flowering stage	48.433
SRP132670	SRR6706286	Control	33.677
	SRR6706287	Light intensity 50%	31.688
	SRR6706288	Light intensity 20%	37.228
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.440
	CNS0095593	Slightly white alabastrum(diploid) 2	60.448
	CNS0095594	Slightly white alabastrum(diploid) 3	49.055
	CNS0095595	Whole white alabastrum(diploid) 2	56.688
	CNS0095596	Whole white alabastrum(diploid) 3	55.784
	CNS0095597	Whole white alabastrum(diploid) 4	57.002
	CNS0095598	Silvery flower (diploied) 1	42.064
	CNS0095599	Silvery flower (diploied) 2	43.671
	CNS0095600	Silvery flower (diploied) 3	62.517
	CNS0095601	Golden flower (diploid) 1	39.644
	CNS0095602	Golden flower (diploid) 2	62.592
	CNS0095603	Golden flower (diploid) 3	61.264
	CNS0095604	Slightly white alabastrum(tetraploid) 1	61.217
	CNS0095605	Slightly white alabastrum(tetraploid) 2	62.798
	CNS0095606	Slightly white alabastrum(tetraploid) 3	67.547
	CNS0095607	Whole white alabastrum(tetraploid) 1	56.447
	CNS0095608	Whole white alabastrum(tetraploid) 2	53.555
	CNS0095609	Whole white alabastrum(tetraploid) 3	61.468
	CNS0095610	Silvery flower (tetraploid) 1	60.171
	CNS0095611	Silvery flower (tetraploid) 2	67.747
	CNS0095612	Silvery flower (tetraploid) 3	74.597
	CNS0095613	Golden flower (tetraploid) 1	53.890
	CNS0095614	Golden flower (tetraploid) 2	55.438
	CNS0095615	Golden flower (tetraploid) 3	91.062
CRA001975	CRR073297	Stem 1	57.962
	CRR073298	Stem 2	50.422
	CRR073299	Stem 3	64.732
	CRR073300	Leaf 1	76.234
	CRR073301	Leaf 2	88.045
	CRR073302	Leaf 3	78.244
	CRR073303	Juvenile bud 1	100.100
	CRR073304	Juvenile bud 2	76.485
	CRR073305	Juvenile bud 3	89.060
	CRR073306	Third green 1	66.002
	CRR073307	Third green 2	74.966
	CRR073308	Third green 3	73.101
	CRR073309	Second white 1	66.935
	CRR073310	Second white 2	65.507
	CRR073311	Second white 3	57.701
	CRR073312	Silver flowering 1	66.548
	CRR073313	Silver flowering 2	68.777
	CRR073314	Silver flowering 3	67.209
	CRR073315	Gold flowering 1	43.968
	CRR073316	Gold flowering 2	41.397
	CRR073317	Gold flowering 3	41.203
	CRR073318	Tawny withering 1	57.700
	CRR073319	Tawny withering 2	63.085
	CRR073320	Tawny withering 3	70.592