Gene detail

Detail information of GWHGAAZE021144

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009607084.1	4.84575E-24	PREDICTED: eukaryotic translation initiation factor 2 subunit beta-like [Nicotiana tomentosiformis]
Swissprot	tr\|P55871\|IF2B_MALDO	5E-21	Eukaryotic translation initiation factor 2 subunit beta
trEMBL	tr\|A0A068VI28\|A0A068VI28_COFCA	3E-23	Coffea canephora DH200=94 genomic scaffold, scaffold_1269 {ECO:0000313\|EMBL:CDP20490.1}
TAIR10	AT5G20920.3	7E-16	eukaryotic translation initiation factor 2 beta subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	35844975	35845385	+
GWHAAZE00000006	mRNA	35844975	35845385	+
GWHAAZE00000006	exon	35844975	35845078	+
GWHAAZE00000006	exon	35845151	35845385	+
GWHAAZE00000006	CDS	35844975	35845078	+
GWHAAZE00000006	CDS	35845151	35845385	+

Transcript Sequence
>GWHTAAZE021168 ATGGCAGAGGAAGATAATCAAAGTGAAATGAAGGAAGAGGTGGAAGATATTGCCACTTTTGATCCTACTAAGAAGAAGGTTGTAATTCAAGATCCTGCTGATGACTTGAAAAAGAAGAAAAAGAAACCAGTGCAGACTGATATCTTAGAAGAGGAGGCAGAAAATGTGGGTGATGATTTGAATGATCCCGCTGCAGAGGAGGAGGAAGGAGAAGGAATTGTACTGCAGCAACAACAACGATTGCCTTGGGAAGGGAGTGATAGAGATTATGAATACGATGACCTTTTGGGCCGGGTCTTTGGAACTTTGCAAAACTATGCATTGTGTGCCCGAGCATAG

Network for GWHGAAZE021144

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03238	EIF2S2	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.206
	SRR3591707	mature leaf	0.466
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.243
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.436
	SRR3591712	Green floral bud	0.314
	SRR3591713	Yellow flower	0.466
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.278
	SRR8316897	Juvenile bud stage	0.067
	SRR8316894	Third green stage	0.301
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.153
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.146
SRP132670	SRR6706286	Control	0.076
	SRR6706287	Light intensity 50%	0.149
	SRR6706288	Light intensity 20%	0.147
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.142
	CNS0095593	Slightly white alabastrum(diploid) 2	0.166
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.127
	CNS0095596	Whole white alabastrum(diploid) 3	0.122
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.113
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.599
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.324
	CNS0095603	Golden flower (diploid) 3	0.219
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.542
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.439
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.810
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.718
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.187
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	1.024
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.308
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.234
	CRR073299	Stem 3	0.370
	CRR073300	Leaf 1	0.566
	CRR073301	Leaf 2	0.129
	CRR073302	Leaf 3	0.121
	CRR073303	Juvenile bud 1	0.256
	CRR073304	Juvenile bud 2	0.111
	CRR073305	Juvenile bud 3	0.135
	CRR073306	Third green 1	0.125
	CRR073307	Third green 2	0.578
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.582
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.074
	CRR073318	Tawny withering 1	0.418
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000