Gene detail

Detail information of GWHGAAZE021184

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004493946.1	8.46787E-31	PREDICTED: 40S ribosomal protein S23-like [Cicer arietinum]
COG	YP_003435202.1	8E-18	30S ribosomal protein S12
Swissprot	tr\|Q9M5Z9\|RS23_EUPES	5E-31	40S ribosomal protein S23
trEMBL	tr\|I1NA60\|I1NA60_SOYBN	5E-30	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA19G36250.2}
TAIR10	AT5G02960.1	5E-25	Ribosomal protein S12/S23 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	37934152	37934683	-
GWHAAZE00000006	mRNA	37934152	37934683	-
GWHAAZE00000006	exon	37934548	37934683	-
GWHAAZE00000006	exon	37934152	37934306	-
GWHAAZE00000006	CDS	37934548	37934683	-
GWHAAZE00000006	CDS	37934152	37934306	-

Transcript Sequence
>GWHTAAZE021208 ATGGTTATTGACAAATTGTTGATTGCTTTTTGTAGTGGGATTGAGGCTAAGCAGCCCAACTCTACTATCACAAAGTTTGCTTGTGTTCAGCTGATTAAAAATGGGAAGAAGATTGCTGCCTTTGTACCCAATGATGGATTCGAAAGGAAGGGGCATGTTGTGGGAGATATTCCTGGAGTGAAGTTCAAGGCTGTGAAGCTATCTGGTGTCTCTCTTTTTTATTTATTCAAAGAGAAGAAGGAGAAGCCTAATTTCAATAGTTGGAGTTCTTGGATTGTTGGATGGTTTTGA

Network for GWHGAAZE021184

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00164.26	Ribosom_S12_S23	12	83	1.90E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02973	RP-S23e, RPS23	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.751
	SRR3591706	second leaf	2.320
	SRR3591707	mature leaf	1.418
	SRR3591708	Shoot apex	1.873
	SRR3591709	Stem	1.769
	SRR3591710	White floral bud	2.934
	SRR3591711	White flower	0.605
	SRR3591712	Green floral bud	5.414
	SRR3591713	Yellow flower	1.015
SRP173429	SRR8316895	Juvenile bud stage	1.729
	SRR8316896	Juvenile bud stage	2.544
	SRR8316897	Juvenile bud stage	0.580
	SRR8316894	Third green stage	0.900
	SRR8316900	Third green stage	3.565
	SRR8316901	Third green stage	3.313
	SRR8316898	Complete white stage	0.246
	SRR8316899	Complete white stage	2.179
	SRR8316903	Complete white stage	0.592
	SRR8316902	Silver flowering stage	0.437
	SRR8316904	Silver flowering stage	0.670
	SRR8316905	Silver flowering stage	0.137
	SRR8316906	Gold flowering stage	0.238
	SRR8316907	Gold flowering stage	0.516
	SRR8316908	Gold flowering stage	0.208
SRP132670	SRR6706286	Control	0.403
	SRR6706287	Light intensity 50%	0.345
	SRR6706288	Light intensity 20%	0.274
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.361
	CNS0095593	Slightly white alabastrum(diploid) 2	5.019
	CNS0095594	Slightly white alabastrum(diploid) 3	6.992
	CNS0095595	Whole white alabastrum(diploid) 2	6.474
	CNS0095596	Whole white alabastrum(diploid) 3	8.749
	CNS0095597	Whole white alabastrum(diploid) 4	8.049
	CNS0095598	Silvery flower (diploied) 1	2.492
	CNS0095599	Silvery flower (diploied) 2	1.469
	CNS0095600	Silvery flower (diploied) 3	0.286
	CNS0095601	Golden flower (diploid) 1	1.951
	CNS0095602	Golden flower (diploid) 2	0.789
	CNS0095603	Golden flower (diploid) 3	0.782
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.099
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.509
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.107
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.742
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.732
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.126
	CNS0095610	Silvery flower (tetraploid) 1	1.000
	CNS0095611	Silvery flower (tetraploid) 2	1.827
	CNS0095612	Silvery flower (tetraploid) 3	1.363
	CNS0095613	Golden flower (tetraploid) 1	1.037
	CNS0095614	Golden flower (tetraploid) 2	0.862
	CNS0095615	Golden flower (tetraploid) 3	0.558
CRA001975	CRR073297	Stem 1	1.638
	CRR073298	Stem 2	2.584
	CRR073299	Stem 3	0.576
	CRR073300	Leaf 1	2.052
	CRR073301	Leaf 2	1.158
	CRR073302	Leaf 3	0.655
	CRR073303	Juvenile bud 1	0.480
	CRR073304	Juvenile bud 2	0.039
	CRR073305	Juvenile bud 3	0.415
	CRR073306	Third green 1	0.227
	CRR073307	Third green 2	0.324
	CRR073308	Third green 3	0.120
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.364
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.094
	CRR073314	Silver flowering 3	0.150
	CRR073315	Gold flowering 1	0.279
	CRR073316	Gold flowering 2	0.267
	CRR073317	Gold flowering 3	0.525
	CRR073318	Tawny withering 1	0.771
	CRR073319	Tawny withering 2	0.729
	CRR073320	Tawny withering 3	0.467