Gene detail

Detail information of GWHGAAZE021214

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05514.1	3.34914E-13	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q7XBQ9\|RGA2_SOLBU	0.000000002	Disease resistance protein RGA2
trEMBL	tr\|A0A068UBE0\|A0A068UBE0_COFCA	1E-13	Coffea canephora DH200=94 genomic scaffold, scaffold_16 {ECO:0000313\|EMBL:CDP05514.1}
TAIR10	AT3G46710.1	0.0000002	NB-ARC domain-containing disease resistance protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	38987978	38988412	+
GWHAAZE00000006	mRNA	38987978	38988412	+
GWHAAZE00000006	exon	38987978	38988412	+
GWHAAZE00000006	CDS	38987978	38988412	+

Transcript Sequence
>GWHTAAZE021238 ATGGAAGAAGAATCTCCAATTCGCCTTAAAAATGAAGCAACTAAACTACTAATTCGAAGGCTTACTTCAACAACACAAAAGCAACTCGATGCTATCTCCATAGTAGGAATTGCTGGAATTGGTAACACCTCTTTGGCTAAAACAGTCTATGAAAATCCATCTGTTGTTTATCACTTTCACACTCGCATTTGGTTCACAGTTTCTCATTTTAGAGATAATAGGAAAATTCTGTGTCATATCTTAACTTGTTTGAAATCACGATTTGATAGTTGTAGTTTTCGTTGTATGCAGTTTTTGATAGAAAATGAAAGTTGGGTTCTATTGGAAGAAAATCTGGGGAAAAAGAAGAGGAAAGAGATTTTGTTTACTAAAGGTAATGTTTGGTCATCAAGGATGAGTGGTCAAGTGTGGAGGAAAAAATGTGGTGGGATTTGA

Network for GWHGAAZE021214

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0127

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00931.23	NB-ARC	17	87	1.80E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0043531	molecular_function	ADP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.416
	SRR3591706	second leaf	5.036
	SRR3591707	mature leaf	8.227
	SRR3591708	Shoot apex	4.203
	SRR3591709	Stem	7.002
	SRR3591710	White floral bud	2.054
	SRR3591711	White flower	1.103
	SRR3591712	Green floral bud	1.597
	SRR3591713	Yellow flower	0.247
SRP173429	SRR8316895	Juvenile bud stage	11.175
	SRR8316896	Juvenile bud stage	10.231
	SRR8316897	Juvenile bud stage	1.800
	SRR8316894	Third green stage	7.317
	SRR8316900	Third green stage	14.294
	SRR8316901	Third green stage	10.187
	SRR8316898	Complete white stage	2.608
	SRR8316899	Complete white stage	9.385
	SRR8316903	Complete white stage	7.780
	SRR8316902	Silver flowering stage	2.186
	SRR8316904	Silver flowering stage	6.306
	SRR8316905	Silver flowering stage	2.682
	SRR8316906	Gold flowering stage	3.623
	SRR8316907	Gold flowering stage	3.374
	SRR8316908	Gold flowering stage	1.800
SRP132670	SRR6706286	Control	5.760
	SRR6706287	Light intensity 50%	8.332
	SRR6706288	Light intensity 20%	6.824
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.752
	CNS0095593	Slightly white alabastrum(diploid) 2	1.209
	CNS0095594	Slightly white alabastrum(diploid) 3	0.965
	CNS0095595	Whole white alabastrum(diploid) 2	2.530
	CNS0095596	Whole white alabastrum(diploid) 3	0.420
	CNS0095597	Whole white alabastrum(diploid) 4	2.450
	CNS0095598	Silvery flower (diploied) 1	8.104
	CNS0095599	Silvery flower (diploied) 2	3.010
	CNS0095600	Silvery flower (diploied) 3	6.507
	CNS0095601	Golden flower (diploid) 1	2.509
	CNS0095602	Golden flower (diploid) 2	6.228
	CNS0095603	Golden flower (diploid) 3	4.976
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.007
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.118
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.401
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.230
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.179
	CNS0095612	Silvery flower (tetraploid) 3	0.309
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.080
CRA001975	CRR073297	Stem 1	4.386
	CRR073298	Stem 2	4.035
	CRR073299	Stem 3	0.570
	CRR073300	Leaf 1	3.903
	CRR073301	Leaf 2	2.613
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.086
	CRR073305	Juvenile bud 3	0.927
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.600
	CRR073309	Second white 1	0.404
	CRR073310	Second white 2	0.158
	CRR073311	Second white 3	0.123
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.033
	CRR073315	Gold flowering 1	1.323
	CRR073316	Gold flowering 2	1.837
	CRR073317	Gold flowering 3	0.367
	CRR073318	Tawny withering 1	0.602
	CRR073319	Tawny withering 2	1.044
	CRR073320	Tawny withering 3	1.252