Gene detail

Detail information of GWHGAAZE021322

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009771970.1	5.71356E-33	PREDICTED: RPM1-interacting protein 4-like isoform X1 [Nicotiana sylvestris]
Swissprot	tr\|Q8GYN5\|RIN4_ARATH	1E-16	RPM1-interacting protein 4
trEMBL	tr\|K4DHL7\|K4DHL7_SOLLC	5E-33	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc12g098440.1.1}
TAIR10	AT3G25070.1	2E-11	RPM1 interacting protein 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	45465822	45468308	+
GWHAAZE00000006	mRNA	45465822	45468308	+
GWHAAZE00000006	exon	45465822	45465995	+
GWHAAZE00000006	exon	45466184	45466445	+
GWHAAZE00000006	exon	45467101	45467147	+
GWHAAZE00000006	exon	45468105	45468308	+
GWHAAZE00000006	CDS	45465822	45465995	+
GWHAAZE00000006	CDS	45466184	45466445	+
GWHAAZE00000006	CDS	45467101	45467147	+
GWHAAZE00000006	CDS	45468105	45468308	+

Transcript Sequence
>GWHTAAZE021346 GAGCGGTCAGTGCAGTCAGAGCGGTCAGTACCACCAAAGTTTGGCAGCTGGAGTGGAGAAAATGAGTACACGGAATATTTTGAGAGAGCAAGGAAAGGTAGAAGTGGTGCAAAGAGGAAGCCAAATGATCCTACTCAGAGTGAAGAACCAAGGGGCCAACAGGTACCAGAGGTGGCAACCAACGTTAATTCACCTCATCATCGGCATGGGGGCGTAAGCACTGTTGATGATGGATCTAAGTGGGCCACACGGCAGAGCACGGGGTTCGATCGGAGCATTGAACAGTCGCCGCTACATCCAAATCACCAGGCAAGGGTTGTGAACAAAGGCAGCGGAGTTTCTTCTCCATCGTGGGAGAAAAAGGGTGAAGGTAGCCATGGGGCCACCACTCCTGGAAGAACACGTTTTGATCATCAGGCACTCGTGGAGCGAAACTTATTGAAACTTGATTTCCTTTCCATTTTTATTCGTGAAAGTTTAGCAACTGATGAGGGGCCTACTGTTCCGAAATTCGGAGATTGGGATGAAAATGATCCAACATCAGGTGAAGGATTCACACAAGTATTCGAATTGGTAAGAGATGAGAAAAATAGTGCTGGAAAGGCCCCTATAACTTCAAATGCGTCTTCTTCTGGTCCGAATGGTCAGAACCGACGTGGAATTGAAAGTTCAAAGGTATATGATTGA

Network for GWHGAAZE021322

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05627.12	AvrRpt-cleavage	163	198	6.10E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13456	RIN4	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.531
	SRR3591706	second leaf	2.154
	SRR3591707	mature leaf	1.869
	SRR3591708	Shoot apex	2.713
	SRR3591709	Stem	3.301
	SRR3591710	White floral bud	3.732
	SRR3591711	White flower	5.296
	SRR3591712	Green floral bud	4.693
	SRR3591713	Yellow flower	4.396
SRP173429	SRR8316895	Juvenile bud stage	1.996
	SRR8316896	Juvenile bud stage	1.845
	SRR8316897	Juvenile bud stage	1.099
	SRR8316894	Third green stage	1.152
	SRR8316900	Third green stage	2.801
	SRR8316901	Third green stage	2.870
	SRR8316898	Complete white stage	1.433
	SRR8316899	Complete white stage	4.206
	SRR8316903	Complete white stage	2.521
	SRR8316902	Silver flowering stage	1.582
	SRR8316904	Silver flowering stage	3.198
	SRR8316905	Silver flowering stage	1.966
	SRR8316906	Gold flowering stage	2.596
	SRR8316907	Gold flowering stage	3.229
	SRR8316908	Gold flowering stage	4.567
SRP132670	SRR6706286	Control	3.117
	SRR6706287	Light intensity 50%	3.840
	SRR6706288	Light intensity 20%	3.788
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.374
	CNS0095593	Slightly white alabastrum(diploid) 2	3.367
	CNS0095594	Slightly white alabastrum(diploid) 3	1.643
	CNS0095595	Whole white alabastrum(diploid) 2	2.112
	CNS0095596	Whole white alabastrum(diploid) 3	1.360
	CNS0095597	Whole white alabastrum(diploid) 4	1.502
	CNS0095598	Silvery flower (diploied) 1	3.937
	CNS0095599	Silvery flower (diploied) 2	2.244
	CNS0095600	Silvery flower (diploied) 3	2.813
	CNS0095601	Golden flower (diploid) 1	2.044
	CNS0095602	Golden flower (diploid) 2	2.137
	CNS0095603	Golden flower (diploid) 3	1.412
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.878
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.524
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.752
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.452
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.087
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.912
	CNS0095610	Silvery flower (tetraploid) 1	4.066
	CNS0095611	Silvery flower (tetraploid) 2	1.872
	CNS0095612	Silvery flower (tetraploid) 3	1.564
	CNS0095613	Golden flower (tetraploid) 1	3.531
	CNS0095614	Golden flower (tetraploid) 2	2.695
	CNS0095615	Golden flower (tetraploid) 3	1.773
CRA001975	CRR073297	Stem 1	2.146
	CRR073298	Stem 2	1.606
	CRR073299	Stem 3	1.344
	CRR073300	Leaf 1	1.990
	CRR073301	Leaf 2	2.545
	CRR073302	Leaf 3	1.338
	CRR073303	Juvenile bud 1	1.419
	CRR073304	Juvenile bud 2	0.912
	CRR073305	Juvenile bud 3	1.460
	CRR073306	Third green 1	1.010
	CRR073307	Third green 2	1.484
	CRR073308	Third green 3	0.825
	CRR073309	Second white 1	0.232
	CRR073310	Second white 2	0.646
	CRR073311	Second white 3	0.172
	CRR073312	Silver flowering 1	0.139
	CRR073313	Silver flowering 2	0.029
	CRR073314	Silver flowering 3	0.147
	CRR073315	Gold flowering 1	0.559
	CRR073316	Gold flowering 2	1.296
	CRR073317	Gold flowering 3	0.539
	CRR073318	Tawny withering 1	2.067
	CRR073319	Tawny withering 2	5.010
	CRR073320	Tawny withering 3	2.723