Gene detail

Detail information of GWHGAAZE021453

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002264264.3	4.8705E-25	PREDICTED: F-box/LRR-repeat protein At3g48880-like [Vitis vinifera]
Swissprot	tr\|Q9M2Z5\|FBL53_ARATH	0.0000003	F-box/LRR-repeat protein At3g48880
trEMBL	tr\|A5BQB5\|A5BQB5_VITVI	8E-25	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN63731.1}
TAIR10	AT3G48880.2	0.000001	RNI-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	53561349	53564730	+
GWHAAZE00000006	mRNA	53561349	53564730	+
GWHAAZE00000006	exon	53561349	53561393	+
GWHAAZE00000006	exon	53563237	53563581	+
GWHAAZE00000006	exon	53564590	53564730	+
GWHAAZE00000006	CDS	53561349	53561393	+
GWHAAZE00000006	CDS	53563237	53563581	+
GWHAAZE00000006	CDS	53564590	53564730	+

Transcript Sequence
>GWHTAAZE021477 ATGAGCGCAGAAAATAATTTGGAAGTTTGTGATGATGATTCTCAGATGGAAATAAGAAAATGGGAGGATTTAAGCACGGATTGCTTGGTGAATGTTTTGGGGCTAGTGGGAATAGAATCATTGATATTGGCTGTACCATTTGTCTGCAAGTCATGGTACAATGCCACTCGCAGTCCCCTTTGCTGGCAAAATCTCGATTTATCTACAGTCTCTTTATTCCAGTTTTTCAAGCCTCCTTTTGAAAAAAGAGTAAGGGCTGGAATAACTGGGAAAATCAGTTTAACAGCATTCATTAAGTGTGTAATCCTTCGTAGCAGCGGATTTGCCACAAGGATTGCCTTTCCTGGACGCTGTGAACATGAGGCACTGGTTGTTGCTGCTAATGTGCAATACAGTGAAATACCTCTTGAACAAGAAGAACCATTGTTATTTGGAATCTGCGCCGAAGTTGGATTGGAAGGTGGATTCGCATTGGAGACGAAAGGTGGAAAGCCGTTGGTTTTACCTATGAATCGAATGTATTTGGATTAA

Network for GWHGAAZE021453

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	20	64	6.90E-06

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.652
	SRR3591710	White floral bud	1.237
	SRR3591711	White flower	0.070
	SRR3591712	Green floral bud	0.742
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.940
	SRR8316896	Juvenile bud stage	0.790
	SRR8316897	Juvenile bud stage	0.238
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.900
	SRR8316901	Third green stage	0.431
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.417
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.169
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.107
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.069
	SRR6706287	Light intensity 50%	0.086
	SRR6706288	Light intensity 20%	0.232
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.208
	CNS0095593	Slightly white alabastrum(diploid) 2	0.819
	CNS0095594	Slightly white alabastrum(diploid) 3	2.113
	CNS0095595	Whole white alabastrum(diploid) 2	1.997
	CNS0095596	Whole white alabastrum(diploid) 3	1.710
	CNS0095597	Whole white alabastrum(diploid) 4	0.996
	CNS0095598	Silvery flower (diploied) 1	0.588
	CNS0095599	Silvery flower (diploied) 2	0.423
	CNS0095600	Silvery flower (diploied) 3	0.100
	CNS0095601	Golden flower (diploid) 1	0.258
	CNS0095602	Golden flower (diploid) 2	0.111
	CNS0095603	Golden flower (diploid) 3	0.047
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.312
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.001
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.702
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.007
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.433
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.715
	CNS0095610	Silvery flower (tetraploid) 1	0.016
	CNS0095611	Silvery flower (tetraploid) 2	0.070
	CNS0095612	Silvery flower (tetraploid) 3	0.449
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.242
	CNS0095615	Golden flower (tetraploid) 3	0.184
CRA001975	CRR073297	Stem 1	0.159
	CRR073298	Stem 2	0.616
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.251
	CRR073301	Leaf 2	0.694
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.119
	CRR073304	Juvenile bud 2	0.178
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.187
	CRR073307	Third green 2	0.195
	CRR073308	Third green 3	0.241
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.261
	CRR073314	Silver flowering 3	0.086
	CRR073315	Gold flowering 1	0.129
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.699
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.120