Gene detail

Detail information of GWHGAAZE021585

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP02334.1	1.82123E-90	unnamed protein product [Coffea canephora]
COG	YP_006915967.1	2E-19	PASTA sensor-containing serine/threonine protein kinase
Swissprot	tr\|Q9FN92\|Y5597_ARATH	1E-82	Probable receptor-like protein kinase At5g59700 (Precursor)
trEMBL	tr\|A0A068U2D1\|A0A068U2D1_COFCA	7E-91	Coffea canephora DH200=94 genomic scaffold, scaffold_8 {ECO:0000313\|EMBL:CDP02334.1}
TAIR10	AT5G59700.1	1E-71	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57360733	57361437	+
GWHAAZE00000006	mRNA	57360733	57361437	+
GWHAAZE00000006	exon	57360733	57361437	+
GWHAAZE00000006	CDS	57360733	57361437	+

Transcript Sequence
>GWHTAAZE021609 ATGCTATCGAAATTTCGACACTGTCATCTCGTATCTTTGATCGGTTACTGTGATGACTCTAATGAGATGATTCTTGTTTACGAATATATGATTCGTGGAACACTTGCTGATCATCTGCACAAAAAAGTCGGTGGAGATGGTAATTCTCCTTTATCCTGGGTGCGACGCCTCAAGATCTGCATAGGGGCTGCACGTGGGCTAGACTACCTACATACTGGTACAGGGATCTTACAAACAGTCATACACCGTGATGTGAAGAGTTCCAACATATTGATCGATGAAAATTGGGCAGCTAAGATTTCGGACTTTGGTTTGTCCAAAATAGGCTCTACAGATCAGGGATTGACCGATGTCAGCACCAAGGTTAAGGGCACGCTTGGGTATCTCGATCCTGAGTATCTCTTGACCCTTAGATTGACGAGAAAATCAGATGTGTACTCGTTTGGGGTTGTATTGATGGAAGTATTGTGTGGGAGGCCAGCACTTGATCCAAGACTCCAGTGGGAGCAAAGAAGTCTAGCGAGATGGGCCCAACAATGTATCAAAGAAAAAAGAGTGAGTCAGATTATTGATCCCAATTTGAAGTGGGAAATCTTTCCGAATTCATTGACGACGTTTGTGGAACTTGCCGACCGGTGTTTACATAATTATCCAAAGAAACGCCCTAAAATGTCTGGCGTCGTGACAGATCTTGAGCAGGCATTA

Network for GWHGAAZE021585

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0261

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	1	231	2.20E-38

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.005
	SRR3591706	second leaf	4.574
	SRR3591707	mature leaf	5.893
	SRR3591708	Shoot apex	7.127
	SRR3591709	Stem	21.515
	SRR3591710	White floral bud	5.498
	SRR3591711	White flower	8.452
	SRR3591712	Green floral bud	5.364
	SRR3591713	Yellow flower	3.907
SRP173429	SRR8316895	Juvenile bud stage	5.243
	SRR8316896	Juvenile bud stage	11.392
	SRR8316897	Juvenile bud stage	1.764
	SRR8316894	Third green stage	2.042
	SRR8316900	Third green stage	2.557
	SRR8316901	Third green stage	3.174
	SRR8316898	Complete white stage	1.431
	SRR8316899	Complete white stage	9.270
	SRR8316903	Complete white stage	2.207
	SRR8316902	Silver flowering stage	2.179
	SRR8316904	Silver flowering stage	1.974
	SRR8316905	Silver flowering stage	0.449
	SRR8316906	Gold flowering stage	1.811
	SRR8316907	Gold flowering stage	1.459
	SRR8316908	Gold flowering stage	1.689
SRP132670	SRR6706286	Control	4.332
	SRR6706287	Light intensity 50%	7.516
	SRR6706288	Light intensity 20%	6.972
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.893
	CNS0095593	Slightly white alabastrum(diploid) 2	4.640
	CNS0095594	Slightly white alabastrum(diploid) 3	3.951
	CNS0095595	Whole white alabastrum(diploid) 2	3.780
	CNS0095596	Whole white alabastrum(diploid) 3	0.996
	CNS0095597	Whole white alabastrum(diploid) 4	3.710
	CNS0095598	Silvery flower (diploied) 1	6.311
	CNS0095599	Silvery flower (diploied) 2	7.329
	CNS0095600	Silvery flower (diploied) 3	6.870
	CNS0095601	Golden flower (diploid) 1	8.767
	CNS0095602	Golden flower (diploid) 2	8.624
	CNS0095603	Golden flower (diploid) 3	8.075
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.229
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.526
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.749
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.758
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.328
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.837
	CNS0095610	Silvery flower (tetraploid) 1	0.662
	CNS0095611	Silvery flower (tetraploid) 2	0.549
	CNS0095612	Silvery flower (tetraploid) 3	0.684
	CNS0095613	Golden flower (tetraploid) 1	0.377
	CNS0095614	Golden flower (tetraploid) 2	0.335
	CNS0095615	Golden flower (tetraploid) 3	0.129
CRA001975	CRR073297	Stem 1	6.733
	CRR073298	Stem 2	4.387
	CRR073299	Stem 3	3.689
	CRR073300	Leaf 1	7.613
	CRR073301	Leaf 2	6.046
	CRR073302	Leaf 3	6.617
	CRR073303	Juvenile bud 1	8.346
	CRR073304	Juvenile bud 2	6.544
	CRR073305	Juvenile bud 3	9.373
	CRR073306	Third green 1	2.199
	CRR073307	Third green 2	4.427
	CRR073308	Third green 3	3.160
	CRR073309	Second white 1	0.717
	CRR073310	Second white 2	1.673
	CRR073311	Second white 3	0.343
	CRR073312	Silver flowering 1	1.376
	CRR073313	Silver flowering 2	0.906
	CRR073314	Silver flowering 3	0.945
	CRR073315	Gold flowering 1	15.508
	CRR073316	Gold flowering 2	16.440
	CRR073317	Gold flowering 3	8.012
	CRR073318	Tawny withering 1	12.231
	CRR073319	Tawny withering 2	18.362
	CRR073320	Tawny withering 3	14.436