Gene detail

Detail information of GWHGAAZE021605

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009590736.1	8.59893E-38	PREDICTED: probable serine/threonine-protein kinase Cx32, chloroplastic isoform X1 [Nicotiana tomentosiformis]
Swissprot	tr\|Q8H186\|Y3545_ARATH	6E-27	Probable receptor-like protein kinase At3g55450
trEMBL	tr\|M0WL47\|M0WL47_HORVD	3E-34	Uncharacterized protein {ECO:0000313\|EnsemblPlants:MLOC_52578.3}
TAIR10	AT2G07180.2	2E-16	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57792700	57793143	+
GWHAAZE00000006	mRNA	57792700	57793143	+
GWHAAZE00000006	exon	57792700	57793143	+
GWHAAZE00000006	CDS	57792700	57793143	+

Transcript Sequence
>GWHTAAZE021629 ATGCACTATAATTGGTCAGGATGTTTGTATCTGAAAAGCGATGTCTACGGTTTTGGAGTGGTGTTGCTCGAATTACTAACAGGTTTGAGGGTGCTTGATAGAAGGAGGACCACCGAAAAGATGAATTTGGTGGCATGGGCCAAGCCTTTGCTACCTCACAAAAAAAATCCGAGCATGTTAGTGGATCCCAGGCTGGAAAATGATTACCCTCCAGAAGGAGCCTTCAAATTAGCTTCACTTGTAGTACAATGTCTTCAAAATGACCCCAAAGTCCGGCCTTCAATGAACGAAGTATTGCAGTGTTTAGAAAAATTTAAATCCATCAAGAACGGTGACTCCAAAGTGGAGGCGGCTCAGGCTAGGCATCCTACGGTTCAAAGAGAGGTGACACCCTACAAATTCTTGTGGTCATGGATTCGTTGTTTGTGGGGAAGCAACTCATAA

Network for GWHGAAZE021605

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	10	102	1.50E-05

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.098
	SRR3591711	White flower	1.649
	SRR3591712	Green floral bud	1.296
	SRR3591713	Yellow flower	1.220
SRP173429	SRR8316895	Juvenile bud stage	2.094
	SRR8316896	Juvenile bud stage	1.826
	SRR8316897	Juvenile bud stage	1.847
	SRR8316894	Third green stage	1.245
	SRR8316900	Third green stage	2.285
	SRR8316901	Third green stage	1.845
	SRR8316898	Complete white stage	0.689
	SRR8316899	Complete white stage	3.385
	SRR8316903	Complete white stage	2.671
	SRR8316902	Silver flowering stage	0.774
	SRR8316904	Silver flowering stage	1.114
	SRR8316905	Silver flowering stage	0.996
	SRR8316906	Gold flowering stage	2.573
	SRR8316907	Gold flowering stage	1.410
	SRR8316908	Gold flowering stage	1.125
SRP132670	SRR6706286	Control	2.548
	SRR6706287	Light intensity 50%	2.766
	SRR6706288	Light intensity 20%	2.869
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.246
	CNS0095593	Slightly white alabastrum(diploid) 2	0.838
	CNS0095594	Slightly white alabastrum(diploid) 3	1.826
	CNS0095595	Whole white alabastrum(diploid) 2	0.737
	CNS0095596	Whole white alabastrum(diploid) 3	0.808
	CNS0095597	Whole white alabastrum(diploid) 4	0.819
	CNS0095598	Silvery flower (diploied) 1	1.293
	CNS0095599	Silvery flower (diploied) 2	2.813
	CNS0095600	Silvery flower (diploied) 3	1.670
	CNS0095601	Golden flower (diploid) 1	0.537
	CNS0095602	Golden flower (diploid) 2	2.048
	CNS0095603	Golden flower (diploid) 3	1.898
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.088
	CRR073298	Stem 2	2.962
	CRR073299	Stem 3	1.469
	CRR073300	Leaf 1	4.402
	CRR073301	Leaf 2	2.557
	CRR073302	Leaf 3	0.509
	CRR073303	Juvenile bud 1	1.141
	CRR073304	Juvenile bud 2	0.396
	CRR073305	Juvenile bud 3	2.678
	CRR073306	Third green 1	0.450
	CRR073307	Third green 2	0.292
	CRR073308	Third green 3	0.365
	CRR073309	Second white 1	0.072
	CRR073310	Second white 2	0.697
	CRR073311	Second white 3	0.326
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.189
	CRR073316	Gold flowering 2	0.620
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.954
	CRR073319	Tawny withering 2	1.305
	CRR073320	Tawny withering 3	0.921