Gene detail

Detail information of GWHGAAZE021609

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFS64762.1	2.58137E-65	protein kinase, partial [Prunus salicina]
COG	YP_001958461.1	0.000000002	hypothetical protein Aasi_1443
Swissprot	tr\|Q94F62\|BAK1_ARATH	4E-65	BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1 (Precursor)
trEMBL	tr\|J9ZZJ1\|J9ZZJ1_9ROSA	1E-65	Protein kinase {ECO:0000313\|EMBL:AFS64762.1} (Fragment)
TAIR10	AT4G33430.1	8E-56	BRI1-associated receptor kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57884269	57886529	-
GWHAAZE00000006	mRNA	57884269	57886529	-
GWHAAZE00000006	exon	57884269	57884486	-
GWHAAZE00000006	exon	57885300	57885595	-
GWHAAZE00000006	exon	57886496	57886529	-
GWHAAZE00000006	CDS	57886496	57886529	-
GWHAAZE00000006	CDS	57885300	57885595	-
GWHAAZE00000006	CDS	57884304	57884486	-
GWHAAZE00000006	three_prime_UTR	57884269	57884303	-

Transcript Sequence
>GWHTAAZE021633 ATGGCTAATGGAAGTGTCGCATCATCTTTAAGAGAGCGACCAGAAACGCAACCCCCACTTGATTGGCTGACAAGGAAGCAAATTGCACTGGGATCCGCGAGGGGTATAATGTATTTGCATGATCATTGTGACCCCAAGATCATTCACAGAGACATTAAAGCTGCAAACATACTTTTGGATAAGGAGTTTGAAGCAGTTGTTGGAGACTTTGGGTTGGCTAAGCTGATGGACTACAAGGATACGCATGTTACCAACGTCGCGGCACAATTGGACATATACCTCCTGAGTACCTTTCCACTGGAAAACTTCCGAGAAAAGCGATGTTTTCGGGTGAAAGGACTTATGGAGGAAAAGAAGTTAGAAACATTGGTGGACGCGGATCTGAACGGTTGCTACAGTGATGACGAGGTAGAGCAGCTCATCCAGGTGGCTCTGCTCTGCACCCAATGCTCCCGACCGACCGACCCAAGATGTCAGAGGTTGTCAGAATGCTCGGCGATGGTTTGTCCATGAGGTGGGAAGAGTTGCAAAACGATTTAGTTTTCCAA

Network for GWHGAAZE021609

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	20	81	2.80E-12

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-II

KEGG pathway

KO	Enzyme	pathway	mapID
K13416	BAK1	MAPK signaling pathway - plant	map04016
		Plant hormone signal transduction	map04075
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.335
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.165
	SRR3591709	Stem	0.524
	SRR3591710	White floral bud	0.068
	SRR3591711	White flower	0.227
	SRR3591712	Green floral bud	0.030
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	9.255
	SRR8316896	Juvenile bud stage	10.761
	SRR8316897	Juvenile bud stage	0.230
	SRR8316894	Third green stage	0.685
	SRR8316900	Third green stage	2.717
	SRR8316901	Third green stage	4.808
	SRR8316898	Complete white stage	0.422
	SRR8316899	Complete white stage	5.509
	SRR8316903	Complete white stage	0.299
	SRR8316902	Silver flowering stage	0.810
	SRR8316904	Silver flowering stage	0.357
	SRR8316905	Silver flowering stage	0.370
	SRR8316906	Gold flowering stage	0.701
	SRR8316907	Gold flowering stage	0.078
	SRR8316908	Gold flowering stage	0.289
SRP132670	SRR6706286	Control	1.264
	SRR6706287	Light intensity 50%	1.758
	SRR6706288	Light intensity 20%	1.350
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.957
	CNS0095593	Slightly white alabastrum(diploid) 2	7.773
	CNS0095594	Slightly white alabastrum(diploid) 3	7.277
	CNS0095595	Whole white alabastrum(diploid) 2	5.595
	CNS0095596	Whole white alabastrum(diploid) 3	0.496
	CNS0095597	Whole white alabastrum(diploid) 4	3.143
	CNS0095598	Silvery flower (diploied) 1	7.704
	CNS0095599	Silvery flower (diploied) 2	8.759
	CNS0095600	Silvery flower (diploied) 3	3.306
	CNS0095601	Golden flower (diploid) 1	8.243
	CNS0095602	Golden flower (diploid) 2	7.645
	CNS0095603	Golden flower (diploid) 3	6.942
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.037
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.119
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.137
	CNS0095612	Silvery flower (tetraploid) 3	0.249
	CNS0095613	Golden flower (tetraploid) 1	0.060
	CNS0095614	Golden flower (tetraploid) 2	0.167
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	4.163
	CRR073298	Stem 2	3.614
	CRR073299	Stem 3	2.233
	CRR073300	Leaf 1	6.147
	CRR073301	Leaf 2	6.912
	CRR073302	Leaf 3	1.370
	CRR073303	Juvenile bud 1	1.879
	CRR073304	Juvenile bud 2	2.360
	CRR073305	Juvenile bud 3	6.797
	CRR073306	Third green 1	0.823
	CRR073307	Third green 2	1.696
	CRR073308	Third green 3	1.435
	CRR073309	Second white 1	0.408
	CRR073310	Second white 2	1.567
	CRR073311	Second white 3	2.451
	CRR073312	Silver flowering 1	5.997
	CRR073313	Silver flowering 2	3.443
	CRR073314	Silver flowering 3	4.894
	CRR073315	Gold flowering 1	2.324
	CRR073316	Gold flowering 2	5.858
	CRR073317	Gold flowering 3	2.197
	CRR073318	Tawny withering 1	4.674
	CRR073319	Tawny withering 2	10.060
	CRR073320	Tawny withering 3	7.776