Gene detail

Detail information of GWHGAAZE021634

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDX74491.1	2.43519E-37	BnaA04g08980D [Brassica napus]
Swissprot	tr\|Q9FID9\|Y5389_ARATH	2E-37	Probable receptor-like protein kinase At5g38990 (Precursor)
trEMBL	tr\|A0A078CBN3\|A0A078CBN3_BRANA	9E-38	BnaA04g08980D protein {ECO:0000313\|EMBL:CDX74491.1}
TAIR10	AT5G38990.1	4E-34	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	58580068	58582248	-
GWHAAZE00000006	mRNA	58580068	58582248	-
GWHAAZE00000006	exon	58581867	58582248	-
GWHAAZE00000006	exon	58581118	58581369	-
GWHAAZE00000006	exon	58580068	58580252	-
GWHAAZE00000006	CDS	58581867	58582248	-
GWHAAZE00000006	CDS	58581118	58581369	-
GWHAAZE00000006	CDS	58580068	58580252	-

Transcript Sequence
>GWHTAAZE021658 ATGTTCAGTCCCCCATCGGAGCACTTATGCCGTCGCTTTTCACTCCATGAGATTCTATTGGCGACCAACAATTTCGACGATTCCCTGGTTATAGGTAAGGGTGGATTTGGTAACGTTTACAAAGGGAATATCATTGATAATAATGGTAATGGTGCATCATCATCCACTACTGTTGCTATAAAGCGTTTAAAGCCCTTGTCTAAGCAAGGTGCCCCTGAGTTTTGGAATGAGATTACTATGCTTTCTAGGTTTCGACACAGCCACCTTGTTTCCTTGATTGGGTACTGCGATAATTGTAATGAAATGATCCTTGTTTACGAGTATATGGTCCATGGAACCCTAGCTGACCATGTGCACAACATTAATAGAAAAAACGATAAGGATCAATGCTTGCATAGTCGTCCAAAGCAGCGTCCTACAATGTCTGAGGTGGTGGCGAAACTTGAGCTTGCATTGGCATTTCAACTGCGCACTGATCTTGTGATCGAGGATTATTCATTTAACACTTGTTTGCCTATTAACAACCAAGAAAATCCGGTTTCTTATCTGGAGGACAACCATATTGATAAGGTTCTACAGCATGGCAATTCAAGCAGCAAACCGTTTTCCCCAGTTGGAGCTCCGGTGGTCTTGGGTTTTGTTTTAGACTACAATGTCATGGGTCAACGCTCTACAATGAACCTAGCTAAAGAAGCCTATCCCGATAAAATGGTGGGATCCACATTGACTCCCGCCAGTCTACTCTTAGCCATATTTATGGGAAGCCTTAGGATGCACTTCAAAACCCTCAACATGCATAATATGACTCAAGCTCCTTAG

Network for GWHGAAZE021634

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	30	121	1.50E-16

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.796
	SRR3591706	second leaf	0.389
	SRR3591707	mature leaf	0.569
	SRR3591708	Shoot apex	0.974
	SRR3591709	Stem	2.053
	SRR3591710	White floral bud	0.784
	SRR3591711	White flower	1.486
	SRR3591712	Green floral bud	0.720
	SRR3591713	Yellow flower	1.085
SRP173429	SRR8316895	Juvenile bud stage	2.622
	SRR8316896	Juvenile bud stage	3.951
	SRR8316897	Juvenile bud stage	1.706
	SRR8316894	Third green stage	0.984
	SRR8316900	Third green stage	1.349
	SRR8316901	Third green stage	2.312
	SRR8316898	Complete white stage	0.470
	SRR8316899	Complete white stage	2.141
	SRR8316903	Complete white stage	1.235
	SRR8316902	Silver flowering stage	0.721
	SRR8316904	Silver flowering stage	1.170
	SRR8316905	Silver flowering stage	0.412
	SRR8316906	Gold flowering stage	1.710
	SRR8316907	Gold flowering stage	1.595
	SRR8316908	Gold flowering stage	1.355
SRP132670	SRR6706286	Control	1.513
	SRR6706287	Light intensity 50%	1.803
	SRR6706288	Light intensity 20%	2.105
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.433
	CNS0095593	Slightly white alabastrum(diploid) 2	1.211
	CNS0095594	Slightly white alabastrum(diploid) 3	1.210
	CNS0095595	Whole white alabastrum(diploid) 2	1.186
	CNS0095596	Whole white alabastrum(diploid) 3	0.411
	CNS0095597	Whole white alabastrum(diploid) 4	1.611
	CNS0095598	Silvery flower (diploied) 1	2.141
	CNS0095599	Silvery flower (diploied) 2	2.766
	CNS0095600	Silvery flower (diploied) 3	2.548
	CNS0095601	Golden flower (diploid) 1	1.850
	CNS0095602	Golden flower (diploid) 2	3.841
	CNS0095603	Golden flower (diploid) 3	3.918
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.735
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.073
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.740
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.436
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.039
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.515
	CNS0095610	Silvery flower (tetraploid) 1	2.078
	CNS0095611	Silvery flower (tetraploid) 2	1.331
	CNS0095612	Silvery flower (tetraploid) 3	1.096
	CNS0095613	Golden flower (tetraploid) 1	0.714
	CNS0095614	Golden flower (tetraploid) 2	1.118
	CNS0095615	Golden flower (tetraploid) 3	0.521
CRA001975	CRR073297	Stem 1	1.884
	CRR073298	Stem 2	1.212
	CRR073299	Stem 3	1.289
	CRR073300	Leaf 1	1.212
	CRR073301	Leaf 2	1.479
	CRR073302	Leaf 3	2.135
	CRR073303	Juvenile bud 1	1.591
	CRR073304	Juvenile bud 2	0.988
	CRR073305	Juvenile bud 3	1.268
	CRR073306	Third green 1	0.318
	CRR073307	Third green 2	0.141
	CRR073308	Third green 3	0.253
	CRR073309	Second white 1	0.169
	CRR073310	Second white 2	0.484
	CRR073311	Second white 3	0.460
	CRR073312	Silver flowering 1	0.925
	CRR073313	Silver flowering 2	1.226
	CRR073314	Silver flowering 3	0.588
	CRR073315	Gold flowering 1	0.962
	CRR073316	Gold flowering 2	2.834
	CRR073317	Gold flowering 3	0.887
	CRR073318	Tawny withering 1	3.169
	CRR073319	Tawny withering 2	1.861
	CRR073320	Tawny withering 3	1.949