Gene detail

Detail information of GWHGAAZE021641

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001235129.1	2.46553E-67	Pti1 kinase-like protein [Glycine max]
Swissprot	tr\|Q41328\|PTI1_SOLLC	1E-61	Pto-interacting protein 1
trEMBL	tr\|Q9LKY3\|Q9LKY3_SOYBN	9E-68	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA17G04410.1}
TAIR10	AT3G17410.1	2E-49	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	58746761	58748591	+
GWHAAZE00000006	mRNA	58746761	58748591	+
GWHAAZE00000006	exon	58746761	58746881	+
GWHAAZE00000006	exon	58747198	58747367	+
GWHAAZE00000006	exon	58748066	58748143	+
GWHAAZE00000006	exon	58748257	58748343	+
GWHAAZE00000006	exon	58748499	58748591	+
GWHAAZE00000006	CDS	58746761	58746881	+
GWHAAZE00000006	CDS	58747198	58747367	+
GWHAAZE00000006	CDS	58748066	58748143	+
GWHAAZE00000006	CDS	58748257	58748343	+
GWHAAZE00000006	CDS	58748499	58748591	+

Transcript Sequence
>GWHTAAZE021665 ATGGCGTCAATGATTAAACACGAAGAAGTGGTTGAGCTACTTAGTTATTGTGTGGATAGTTTTCTCCGTGTCCTTGCCAATGAGTATGCTCCAAATGGATCTCTTCATGACCTTCTTCATGGACGAAAAGGTGTTAAAGGTGCGCAGCCAGGTCCAGCTCTATCATGGTCCCAAAGAGTTAAAATTGCTCTTGGAGCTGTGAAAGGGCTTGAGTACTTGCATGAAGGACATCCCTATCCCATTATCCTTTGCAATATTATGTCCAGCAATGTTTTACTTTTTGATGACGATCCCTACTTGGAACTATTAACCGGGTGTAAACGTGTTGATCATACATCGCCACACAGACAGCAGGATCTGGTGACCTGGGCAATCCCAAAACTTAGTGAAGATAGAGCGAAGGTGTGTATTGACCCTAGATTGCGTGGAGAATACCCTCTCAGAGCAGCTGCAAAGATGGCTGCCGTTGCAGCCTTGTGCCTGCAATATGAAGTTGATGTCTGTCTGAACATGGGAATTTTAGTTAAATCCCCTCCTAACTTCTACTGA

Network for GWHGAAZE021641

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	3	94	3.20E-07

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIII

KEGG pathway

KO	Enzyme	pathway	mapID
K13436	PTI1	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.776
	SRR3591706	second leaf	19.819
	SRR3591707	mature leaf	25.044
	SRR3591708	Shoot apex	28.401
	SRR3591709	Stem	26.656
	SRR3591710	White floral bud	17.555
	SRR3591711	White flower	18.087
	SRR3591712	Green floral bud	22.347
	SRR3591713	Yellow flower	16.281
SRP173429	SRR8316895	Juvenile bud stage	19.653
	SRR8316896	Juvenile bud stage	17.023
	SRR8316897	Juvenile bud stage	12.076
	SRR8316894	Third green stage	10.329
	SRR8316900	Third green stage	21.100
	SRR8316901	Third green stage	24.588
	SRR8316898	Complete white stage	7.941
	SRR8316899	Complete white stage	32.263
	SRR8316903	Complete white stage	14.037
	SRR8316902	Silver flowering stage	6.570
	SRR8316904	Silver flowering stage	8.215
	SRR8316905	Silver flowering stage	4.195
	SRR8316906	Gold flowering stage	11.797
	SRR8316907	Gold flowering stage	11.486
	SRR8316908	Gold flowering stage	11.927
SRP132670	SRR6706286	Control	14.681
	SRR6706287	Light intensity 50%	16.972
	SRR6706288	Light intensity 20%	18.661
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.331
	CNS0095593	Slightly white alabastrum(diploid) 2	17.267
	CNS0095594	Slightly white alabastrum(diploid) 3	18.272
	CNS0095595	Whole white alabastrum(diploid) 2	15.135
	CNS0095596	Whole white alabastrum(diploid) 3	12.559
	CNS0095597	Whole white alabastrum(diploid) 4	10.850
	CNS0095598	Silvery flower (diploied) 1	17.976
	CNS0095599	Silvery flower (diploied) 2	11.225
	CNS0095600	Silvery flower (diploied) 3	9.002
	CNS0095601	Golden flower (diploid) 1	16.968
	CNS0095602	Golden flower (diploid) 2	11.578
	CNS0095603	Golden flower (diploid) 3	9.627
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.609
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.173
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.622
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.408
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.333
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.651
	CNS0095610	Silvery flower (tetraploid) 1	12.033
	CNS0095611	Silvery flower (tetraploid) 2	12.623
	CNS0095612	Silvery flower (tetraploid) 3	9.441
	CNS0095613	Golden flower (tetraploid) 1	11.329
	CNS0095614	Golden flower (tetraploid) 2	14.067
	CNS0095615	Golden flower (tetraploid) 3	11.094
CRA001975	CRR073297	Stem 1	30.330
	CRR073298	Stem 2	23.217
	CRR073299	Stem 3	8.753
	CRR073300	Leaf 1	27.384
	CRR073301	Leaf 2	26.730
	CRR073302	Leaf 3	6.974
	CRR073303	Juvenile bud 1	5.271
	CRR073304	Juvenile bud 2	2.895
	CRR073305	Juvenile bud 3	7.935
	CRR073306	Third green 1	0.629
	CRR073307	Third green 2	0.550
	CRR073308	Third green 3	1.270
	CRR073309	Second white 1	0.498
	CRR073310	Second white 2	0.313
	CRR073311	Second white 3	2.128
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.549
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	4.967
	CRR073316	Gold flowering 2	9.318
	CRR073317	Gold flowering 3	1.298
	CRR073318	Tawny withering 1	14.937
	CRR073319	Tawny withering 2	14.903
	CRR073320	Tawny withering 3	10.802