Gene detail

Detail information of GWHGAAZE021737

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009594840.1	2.2918E-122	PREDICTED: proteasome subunit beta type-2-A [Nicotiana tomentosiformis]
COG	YP_004576726.1	4E-10	proteasome endopeptidase complex subunit beta
Swissprot	tr\|O23714\|PSB2A_ARATH	4E-117	Proteasome subunit beta type-2-A
trEMBL	tr\|M1D5K4\|M1D5K4_SOLTU	1E-122	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400082075}
TAIR10	AT3G22630.1	5E-93	20S proteasome beta subunit D1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	60555381	60560599	+
GWHAAZE00000006	mRNA	60555381	60560599	+
GWHAAZE00000006	exon	60555381	60555538	+
GWHAAZE00000006	exon	60556536	60556659	+
GWHAAZE00000006	exon	60558906	60559001	+
GWHAAZE00000006	exon	60560057	60560599	+
GWHAAZE00000006	CDS	60555381	60555538	+
GWHAAZE00000006	CDS	60556536	60556659	+
GWHAAZE00000006	CDS	60558906	60559001	+
GWHAAZE00000006	CDS	60560057	60560386	+
GWHAAZE00000006	three_prime_UTR	60560387	60560599	+

Transcript Sequence
>GWHTAAZE021761 ATGGAGTGTGTATTCGGACTAGTTGGCAAGGATTTCGCACTGGTGGTGGCGGACACATCGGCGGTTCACAGTATACTGGTTCACAAATCCAACGAAGACAAGATCATGATTCTCGATTCTCACAAGCTCATGGGCGCTAGCGGCGAACCCGGTGACAGAGCTCAATTCACGGAGTATATACAGAAGAATGTGGCTTTGTATCAGTTCCGCAATGGCATTCCGCTGACGACTGCTGCTGCAGCAAATTTCACCCGGGGTGAGCTGGCTACTGCGTTACGAAAGGTTGGTGCTTGGTTTGATGAACATGGTTATAATAATGGTGTAGTACTATACAATGGAACTTCGTGTCAGTTCAAACCTCAAAGGGGTAGTAGAAAGAACCCGTATTCCGTGAATATCATACTTGCTGGCTACGACGAGGAAACAGGCCCTTCTCTATACTATCTTGATTACATTGCTACCCTTCACAAGGTTAACAATACAGCTTTTGGTTACGGATCCTATTTTTCACTCTCCATGATGGATAGATACTACCGCGACATGTCAGTGGAAGAAGCCATCGATTTGGTCGATAAGTGCATCATTGAGATACGGTCCAGACTGGTTGTTGCCCCATCAAACTTTGTAATCAAAATTGTTGACAAAGACGGAGCTAGGGAATATGCTTGGCGTGAAACTGTCAATGATGCCCAAGTTTCTGCGGCGTAGATCTCTTTTTTTTCCTCTGAATGGTTCGACTTAGAAATGGTACATGACCGAGAAACTCTCTTAATATTTAATGTGCCTTTGGTTTGATAGTATGTTAGACTTGTTATGGTATGGGAAAATTCTTGCAGTTTATTGTCCATGAATGAGTTTGGAGCTTTGAAATTAAAACCCCAGTTTTCCTTCTTTTTCTTCTGATCTATCATTACCTTACAA

Network for GWHGAAZE021737

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	3	91	3.00E-15
PF00227.27	Proteasome	124	213	2.30E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02734	PSMB2	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.459
	SRR3591706	second leaf	2.259
	SRR3591707	mature leaf	2.649
	SRR3591708	Shoot apex	2.787
	SRR3591709	Stem	3.783
	SRR3591710	White floral bud	4.203
	SRR3591711	White flower	13.089
	SRR3591712	Green floral bud	8.692
	SRR3591713	Yellow flower	9.592
SRP173429	SRR8316895	Juvenile bud stage	3.712
	SRR8316896	Juvenile bud stage	6.811
	SRR8316897	Juvenile bud stage	1.102
	SRR8316894	Third green stage	1.555
	SRR8316900	Third green stage	11.348
	SRR8316901	Third green stage	12.427
	SRR8316898	Complete white stage	4.656
	SRR8316899	Complete white stage	12.273
	SRR8316903	Complete white stage	2.523
	SRR8316902	Silver flowering stage	6.147
	SRR8316904	Silver flowering stage	6.319
	SRR8316905	Silver flowering stage	3.045
	SRR8316906	Gold flowering stage	17.192
	SRR8316907	Gold flowering stage	14.324
	SRR8316908	Gold flowering stage	13.899
SRP132670	SRR6706286	Control	14.477
	SRR6706287	Light intensity 50%	12.553
	SRR6706288	Light intensity 20%	15.104
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.809
	CNS0095593	Slightly white alabastrum(diploid) 2	17.373
	CNS0095594	Slightly white alabastrum(diploid) 3	12.675
	CNS0095595	Whole white alabastrum(diploid) 2	13.928
	CNS0095596	Whole white alabastrum(diploid) 3	13.170
	CNS0095597	Whole white alabastrum(diploid) 4	9.104
	CNS0095598	Silvery flower (diploied) 1	8.083
	CNS0095599	Silvery flower (diploied) 2	11.631
	CNS0095600	Silvery flower (diploied) 3	9.743
	CNS0095601	Golden flower (diploid) 1	11.199
	CNS0095602	Golden flower (diploid) 2	12.326
	CNS0095603	Golden flower (diploid) 3	12.749
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.718
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.389
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.146
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.834
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.496
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.333
	CNS0095610	Silvery flower (tetraploid) 1	22.521
	CNS0095611	Silvery flower (tetraploid) 2	15.718
	CNS0095612	Silvery flower (tetraploid) 3	14.881
	CNS0095613	Golden flower (tetraploid) 1	21.737
	CNS0095614	Golden flower (tetraploid) 2	20.892
	CNS0095615	Golden flower (tetraploid) 3	22.856
CRA001975	CRR073297	Stem 1	2.955
	CRR073298	Stem 2	7.974
	CRR073299	Stem 3	7.635
	CRR073300	Leaf 1	16.333
	CRR073301	Leaf 2	11.734
	CRR073302	Leaf 3	12.827
	CRR073303	Juvenile bud 1	17.690
	CRR073304	Juvenile bud 2	18.059
	CRR073305	Juvenile bud 3	16.360
	CRR073306	Third green 1	2.624
	CRR073307	Third green 2	7.270
	CRR073308	Third green 3	9.514
	CRR073309	Second white 1	15.388
	CRR073310	Second white 2	20.270
	CRR073311	Second white 3	13.574
	CRR073312	Silver flowering 1	7.163
	CRR073313	Silver flowering 2	5.430
	CRR073314	Silver flowering 3	4.598
	CRR073315	Gold flowering 1	3.522
	CRR073316	Gold flowering 2	5.966
	CRR073317	Gold flowering 3	3.280
	CRR073318	Tawny withering 1	6.005
	CRR073319	Tawny withering 2	10.688
	CRR073320	Tawny withering 3	7.191