Gene detail

Detail information of GWHGAAZE021774

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009593548.1	1.5746E-121	PREDICTED: inosine triphosphate pyrophosphatase {ECO:0000255\|HAMAP-Rule:MF_03148} [Nicotiana tomentosiformis]
COG	YP_001434770.1	3E-32	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
Swissprot	tr\|F6HS55\|ITPA_VITVI	6E-120	Inosine triphosphate pyrophosphatase {ECO:0000255\|HAMAP-Rule:MF_03148}
trEMBL	tr\|A0A067EY21\|A0A067EY21_CITSI	6E-122	Inosine triphosphate pyrophosphatase {ECO:0000256\|HAMAP-Rule:MF_03148}
TAIR10	AT4G13720.1	5E-89	Inosine triphosphate pyrophosphatase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	61157729	61162798	+
GWHAAZE00000006	mRNA	61157729	61162798	+
GWHAAZE00000006	exon	61157729	61157867	+
GWHAAZE00000006	exon	61157971	61158020	+
GWHAAZE00000006	exon	61158790	61158853	+
GWHAAZE00000006	exon	61159447	61159456	+
GWHAAZE00000006	exon	61160460	61160491	+
GWHAAZE00000006	exon	61160585	61160697	+
GWHAAZE00000006	exon	61162311	61162387	+
GWHAAZE00000006	exon	61162678	61162798	+
GWHAAZE00000006	CDS	61157729	61157867	+
GWHAAZE00000006	CDS	61157971	61158020	+
GWHAAZE00000006	CDS	61158790	61158853	+
GWHAAZE00000006	CDS	61159447	61159456	+
GWHAAZE00000006	CDS	61160460	61160491	+
GWHAAZE00000006	CDS	61160585	61160697	+
GWHAAZE00000006	CDS	61162311	61162387	+
GWHAAZE00000006	CDS	61162678	61162798	+

Transcript Sequence
>GWHTAAZE021798 ATGTCGGCAGCAAGGGTGGTCGGATCGGCGCCGGTTCTATCACGTCCGGTGACATTCGTTACCGGCAACTCAAAGAAGCTAGAAGAAGTCCGTGCTATTTTGGGCCAATCCATTCCCTTTCAATCCCTAAAGCTCGATTGTGAACCTGGTGATATTTCTAAAGAAAAAGCTCGATTAGCTGCAAAGGAGGTGAATGGCCCTGTTCTTGTGGAAGACACTTGTCTCTGTTTCAATGCCCTAAAGGGTCTCCCAGGGCCTTACATCAAATGGTTCTTGCAGAAGATTGGTCATGAAGGTCTGAACAATTTGTTGATGGCGTATGAGGATAAATCAGCCTACGCTTTGTGTGTATTTTCTCTTGCTCTTGGACCGAATGAGGAGCCACTTACTTTTCTGGGAAAAACCCCGGGTAAGATAGTTCAACCAAGGGGACCCAATGATTTTGGGTGGGACCCGATTTTTCAACCTGATGGCTATGATCAGACATATGCGGAGATGCCCAAAGAAGAAAAGAACAAGATCTCACACCGCTCAAGGGCTCTTGCGCTGGTGAAATCACACTTTGCTGATGCTGGGTACACTTTCCAGATGAACCTCTCTATTTAA

Network for GWHGAAZE021774

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01725.17	Ham1p_like	17	184	1.10E-51

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01519	ITPA	Metabolic pathways	map01100
		Purine metabolism	map00230
		Drug metabolism - other enzymes	map00983

Gene Ontology

GO term	Ontology	Name
GO:0009143	biological_process	nucleoside triphosphate catabolic process
GO:0047429	molecular_function	nucleoside-triphosphate diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.327
	SRR3591706	second leaf	12.914
	SRR3591707	mature leaf	9.573
	SRR3591708	Shoot apex	35.648
	SRR3591709	Stem	20.576
	SRR3591710	White floral bud	8.717
	SRR3591711	White flower	8.097
	SRR3591712	Green floral bud	12.851
	SRR3591713	Yellow flower	2.984
SRP173429	SRR8316895	Juvenile bud stage	16.793
	SRR8316896	Juvenile bud stage	21.526
	SRR8316897	Juvenile bud stage	7.422
	SRR8316894	Third green stage	9.376
	SRR8316900	Third green stage	30.992
	SRR8316901	Third green stage	24.276
	SRR8316898	Complete white stage	10.879
	SRR8316899	Complete white stage	34.189
	SRR8316903	Complete white stage	11.632
	SRR8316902	Silver flowering stage	8.339
	SRR8316904	Silver flowering stage	6.780
	SRR8316905	Silver flowering stage	4.031
	SRR8316906	Gold flowering stage	10.817
	SRR8316907	Gold flowering stage	14.875
	SRR8316908	Gold flowering stage	8.270
SRP132670	SRR6706286	Control	16.428
	SRR6706287	Light intensity 50%	18.154
	SRR6706288	Light intensity 20%	21.357
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.569
	CNS0095593	Slightly white alabastrum(diploid) 2	24.586
	CNS0095594	Slightly white alabastrum(diploid) 3	25.134
	CNS0095595	Whole white alabastrum(diploid) 2	26.603
	CNS0095596	Whole white alabastrum(diploid) 3	23.896
	CNS0095597	Whole white alabastrum(diploid) 4	20.582
	CNS0095598	Silvery flower (diploied) 1	25.549
	CNS0095599	Silvery flower (diploied) 2	23.148
	CNS0095600	Silvery flower (diploied) 3	17.042
	CNS0095601	Golden flower (diploid) 1	20.964
	CNS0095602	Golden flower (diploid) 2	16.460
	CNS0095603	Golden flower (diploid) 3	16.107
	CNS0095604	Slightly white alabastrum(tetraploid) 1	44.423
	CNS0095605	Slightly white alabastrum(tetraploid) 2	44.347
	CNS0095606	Slightly white alabastrum(tetraploid) 3	67.613
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.067
	CNS0095608	Whole white alabastrum(tetraploid) 2	33.705
	CNS0095609	Whole white alabastrum(tetraploid) 3	58.194
	CNS0095610	Silvery flower (tetraploid) 1	69.964
	CNS0095611	Silvery flower (tetraploid) 2	71.142
	CNS0095612	Silvery flower (tetraploid) 3	76.715
	CNS0095613	Golden flower (tetraploid) 1	58.513
	CNS0095614	Golden flower (tetraploid) 2	57.242
	CNS0095615	Golden flower (tetraploid) 3	35.256
CRA001975	CRR073297	Stem 1	27.710
	CRR073298	Stem 2	26.479
	CRR073299	Stem 3	23.306
	CRR073300	Leaf 1	30.639
	CRR073301	Leaf 2	33.033
	CRR073302	Leaf 3	35.292
	CRR073303	Juvenile bud 1	42.613
	CRR073304	Juvenile bud 2	31.858
	CRR073305	Juvenile bud 3	27.524
	CRR073306	Third green 1	19.054
	CRR073307	Third green 2	14.617
	CRR073308	Third green 3	12.191
	CRR073309	Second white 1	12.419
	CRR073310	Second white 2	9.606
	CRR073311	Second white 3	6.786
	CRR073312	Silver flowering 1	11.005
	CRR073313	Silver flowering 2	6.227
	CRR073314	Silver flowering 3	6.452
	CRR073315	Gold flowering 1	41.374
	CRR073316	Gold flowering 2	45.979
	CRR073317	Gold flowering 3	31.493
	CRR073318	Tawny withering 1	27.854
	CRR073319	Tawny withering 2	28.304
	CRR073320	Tawny withering 3	21.809