Gene detail

Detail information of GWHGAAZE021813

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010445884.1	1.0401E-28	PREDICTED: 3-ketoacyl-CoA synthase 19-like [Camelina sativa]
Swissprot	tr\|O48780\|KCS11_ARATH	6E-30	3-ketoacyl-CoA synthase 11
trEMBL	tr\|U5G1S1\|U5G1S1_POPTR	3E-28	Uncharacterized protein {ECO:0000313\|EMBL:ERP56171.1}
TAIR10	AT2G26640.1	4E-26	3-ketoacyl-CoA synthase 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	61904206	61905406	+
GWHAAZE00000006	mRNA	61904206	61905406	+
GWHAAZE00000006	exon	61904206	61904355	+
GWHAAZE00000006	exon	61904768	61904794	+
GWHAAZE00000006	exon	61905230	61905406	+
GWHAAZE00000006	CDS	61904206	61904355	+
GWHAAZE00000006	CDS	61904768	61904794	+
GWHAAZE00000006	CDS	61905230	61905406	+

Transcript Sequence
>GWHTAAZE021837 ATGGCCGAGGCGAGGAAAGAGGCTGAAATGGTGATGTTTGGTACCATTGATGAGCTTTTGGAGAAGACCGGTGTTAAGGCAAAGGATGTTGGGATACTTGTGGTGAATTGTAGCTTGTTTAATCCGACCCCGTCTCTTTCGGCTATGGTGGTACAACCCAAGTCTTATGCCTTGGTTGAAGATCAAGCGGTGCTGGATGAGTTAGAGAAAAACCTTGAACTTACTGAGTGGCATATGGAGCCTTCGCGAATGACTCTTAACCGATTTGGCAATACATCTAGTAGTTCATTGTGGTATGAATTGGCCTATTCCGAGGCTAAGGGGAGAATCAAAGAGGGTGATCAGATATGGTAA

Network for GWHGAAZE021813

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08392.13	FAE1_CUT1_RppA	1	60	4.00E-21
PF02797.16	Chal_sti_synt_C	62	105	2.40E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15397	KCS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Fatty acid elongation	map00062
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006633	biological_process	fatty acid biosynthetic process
GO:0016020	cellular_component	membrane
GO:0016747	molecular_function	transferase activity, transferring acyl groups other than amino-acyl groups
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.572
	SRR3591706	second leaf	4.132
	SRR3591707	mature leaf	0.816
	SRR3591708	Shoot apex	5.213
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.094
	SRR3591711	White flower	0.132
	SRR3591712	Green floral bud	1.239
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.206
	SRR8316896	Juvenile bud stage	0.163
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.090
	SRR8316900	Third green stage	0.063
	SRR8316901	Third green stage	0.082
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.139
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.065
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.017
	SRR6706287	Light intensity 50%	0.035
	SRR6706288	Light intensity 20%	0.155
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.054
	CNS0095593	Slightly white alabastrum(diploid) 2	0.093
	CNS0095594	Slightly white alabastrum(diploid) 3	0.363
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.019
	CNS0095597	Whole white alabastrum(diploid) 4	0.449
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.397
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.132
	CNS0095603	Golden flower (diploid) 3	0.047
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.015
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.238
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.047
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.026
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.353
	CNS0095613	Golden flower (tetraploid) 1	0.628
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.272
CRA001975	CRR073297	Stem 1	0.121
	CRR073298	Stem 2	0.368
	CRR073299	Stem 3	0.332
	CRR073300	Leaf 1	0.066
	CRR073301	Leaf 2	0.015
	CRR073302	Leaf 3	0.549
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.026
	CRR073306	Third green 1	0.094
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.020
	CRR073310	Second white 2	1.051
	CRR073311	Second white 3	1.839
	CRR073312	Silver flowering 1	4.591
	CRR073313	Silver flowering 2	2.054
	CRR073314	Silver flowering 3	1.272
	CRR073315	Gold flowering 1	0.410
	CRR073316	Gold flowering 2	0.034
	CRR073317	Gold flowering 3	0.732
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.015