Gene detail

Detail information of GWHGAAZE021838

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002285444.1	2.25227E-96	PREDICTED: eukaryotic translation initiation factor isoform 4E-2 [Vitis vinifera]
Swissprot	tr\|Q03389\|IF4E2_WHEAT	1E-89	Eukaryotic translation initiation factor isoform 4E-2
trEMBL	tr\|F6H8U4\|F6H8U4_VITVI	8E-97	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB48619.1}
TAIR10	AT5G35620.2	7E-58	Eukaryotic initiation factor 4E protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	62271173	62272850	+
GWHAAZE00000006	mRNA	62271173	62272850	+
GWHAAZE00000006	exon	62271173	62271381	+
GWHAAZE00000006	exon	62272391	62272559	+
GWHAAZE00000006	exon	62272692	62272850	+
GWHAAZE00000006	CDS	62271173	62271381	+
GWHAAZE00000006	CDS	62272391	62272559	+
GWHAAZE00000006	CDS	62272692	62272850	+

Transcript Sequence
>GWHTAAZE021864 ATGGCGAGTGAAGCGGCGGTTGAATCCAGCGTACCGGAGGCGCAGTCGGAGGTCTCACCGGAGAAAACGACGGTGGTGAAGCAGCCTCACAAGTTGGAGAGGCAGTGGACGTTTTGGTACGACAACCAATCCAAGCCCAAACAAGGCGCTGCTTGGGGCTCCTCCCTCCGCAAGGGTTTTACTTTCGACACTGTCGAAGAATTCTGGTGTTTGTATGATCAGATATTTAGGCCTAGCAAGTTCCCTGCGAATGCAGATTTCCATTTGTTCAAGGCTGGGGTTGAGCCTAAATGGGAAGATCCTGAGTGTGCTAATGGAGGAAAGTGGACTGCTACTAGTGCCAGAAAGGCTAATCTCGACCAGATGTGGCTTGAAACGTTAATGGCCTTGATTGGGGAGCAATTTGATGAGGCCGATGAGATATGTGGTGTGGTTGCCAGTGTGCGTCAAAGGCAGGATAAACTTGCATTATGGACTAAGAATGCTGCTAACGAGGCTGCTCAGGTTTTAACTCAAAATCTTAATTCTGAATGCTGA

Network for GWHGAAZE021838

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01652.19	IF4E	32	174	1.20E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03259	EIF4E	RNA transport	map03013
		HIF-1 signaling pathway	map04066
		PI3K-Akt signaling pathway	map04151
		mTOR signaling pathway	map04150
		Insulin signaling pathway	map04910
		Longevity regulating pathway	map04211

Gene Ontology

GO term	Ontology	Name
GO:0006413	biological_process	translational initiation
GO:0005737	cellular_component	cytoplasm
GO:0003723	molecular_function	RNA binding
GO:0003743	molecular_function	translation initiation factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	143.765
	SRR3591706	second leaf	74.678
	SRR3591707	mature leaf	81.119
	SRR3591708	Shoot apex	169.405
	SRR3591709	Stem	168.377
	SRR3591710	White floral bud	100.671
	SRR3591711	White flower	104.739
	SRR3591712	Green floral bud	163.451
	SRR3591713	Yellow flower	73.987
SRP173429	SRR8316895	Juvenile bud stage	60.481
	SRR8316896	Juvenile bud stage	79.388
	SRR8316897	Juvenile bud stage	33.405
	SRR8316894	Third green stage	32.205
	SRR8316900	Third green stage	107.295
	SRR8316901	Third green stage	120.667
	SRR8316898	Complete white stage	32.546
	SRR8316899	Complete white stage	143.676
	SRR8316903	Complete white stage	45.357
	SRR8316902	Silver flowering stage	31.814
	SRR8316904	Silver flowering stage	34.745
	SRR8316905	Silver flowering stage	19.010
	SRR8316906	Gold flowering stage	68.181
	SRR8316907	Gold flowering stage	64.777
	SRR8316908	Gold flowering stage	76.395
SRP132670	SRR6706286	Control	118.097
	SRR6706287	Light intensity 50%	126.470
	SRR6706288	Light intensity 20%	129.897
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	105.795
	CNS0095593	Slightly white alabastrum(diploid) 2	115.311
	CNS0095594	Slightly white alabastrum(diploid) 3	112.693
	CNS0095595	Whole white alabastrum(diploid) 2	108.391
	CNS0095596	Whole white alabastrum(diploid) 3	127.543
	CNS0095597	Whole white alabastrum(diploid) 4	121.070
	CNS0095598	Silvery flower (diploied) 1	95.338
	CNS0095599	Silvery flower (diploied) 2	76.605
	CNS0095600	Silvery flower (diploied) 3	74.336
	CNS0095601	Golden flower (diploid) 1	122.505
	CNS0095602	Golden flower (diploid) 2	93.366
	CNS0095603	Golden flower (diploid) 3	90.520
	CNS0095604	Slightly white alabastrum(tetraploid) 1	149.249
	CNS0095605	Slightly white alabastrum(tetraploid) 2	128.681
	CNS0095606	Slightly white alabastrum(tetraploid) 3	169.606
	CNS0095607	Whole white alabastrum(tetraploid) 1	141.594
	CNS0095608	Whole white alabastrum(tetraploid) 2	120.061
	CNS0095609	Whole white alabastrum(tetraploid) 3	162.721
	CNS0095610	Silvery flower (tetraploid) 1	84.523
	CNS0095611	Silvery flower (tetraploid) 2	91.074
	CNS0095612	Silvery flower (tetraploid) 3	58.517
	CNS0095613	Golden flower (tetraploid) 1	60.499
	CNS0095614	Golden flower (tetraploid) 2	81.087
	CNS0095615	Golden flower (tetraploid) 3	49.014
CRA001975	CRR073297	Stem 1	111.338
	CRR073298	Stem 2	112.356
	CRR073299	Stem 3	122.803
	CRR073300	Leaf 1	165.232
	CRR073301	Leaf 2	152.550
	CRR073302	Leaf 3	164.879
	CRR073303	Juvenile bud 1	142.192
	CRR073304	Juvenile bud 2	118.355
	CRR073305	Juvenile bud 3	102.703
	CRR073306	Third green 1	32.499
	CRR073307	Third green 2	39.894
	CRR073308	Third green 3	29.777
	CRR073309	Second white 1	39.616
	CRR073310	Second white 2	39.472
	CRR073311	Second white 3	37.400
	CRR073312	Silver flowering 1	35.014
	CRR073313	Silver flowering 2	31.815
	CRR073314	Silver flowering 3	30.667
	CRR073315	Gold flowering 1	100.965
	CRR073316	Gold flowering 2	71.447
	CRR073317	Gold flowering 3	81.857
	CRR073318	Tawny withering 1	139.262
	CRR073319	Tawny withering 2	132.938
	CRR073320	Tawny withering 3	143.529