Gene detail

Detail information of GWHGAAZE021938

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007034503.1	4.98425E-46	GATA transcription factor 1, putative [Theobroma cacao]
Swissprot	tr\|Q8LAU9\|GATA1_ARATH	1E-40	GATA transcription factor 1
trEMBL	tr\|A0A061ESZ5\|A0A061ESZ5_THECC	2E-46	GATA transcription factor 1, putative {ECO:0000313\|EMBL:EOY05429.1}
TAIR10	AT3G24050.1	2E-34	GATA transcription factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	64323980	64324414	+
GWHAAZE00000006	mRNA	64323980	64324414	+
GWHAAZE00000006	exon	64323980	64324056	+
GWHAAZE00000006	exon	64324087	64324414	+
GWHAAZE00000006	CDS	64323980	64324056	+
GWHAAZE00000006	CDS	64324087	64324414	+

Transcript Sequence
>GWHTAAZE021964 ATGAGCTGCTGTGGCACCTTCCAAGTACCCATCCGCTGTCCTGTCAAGCCCCGCAGCAAGAAGCGGCGGAGAGGGAGGTCCTGGAGGTGGTCCCAAGAATCGGCCTTACCACTGCCACGGCAGCTGCCACCACAACCACCAAGTGGGGCCGGTATAGGCCGTAGGTGCCAGCATTGCCTAGCCGAAAAGACCCCTCAATGGCGGGCAGGCCCTATGGGGCCCAAAACATTGTGCAATGCTTGTGGGGTCCGGTACAAGTCTGGTCGGCTCGTGCCTGAGTACCGTCCCGCTAGCAGCCCTACTTTCTCTAGCGAGTTGCATTCGAATTCTCACCGGAAAATAATGGAGATGAGGAGGCAGAGTCACCCCGGAGAGATAGCTGCGAAAGGATATAGGGTAGGGTAG

Network for GWHGAAZE021938

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00320.28	GATA	56	89	8.40E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-GATA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0008270	molecular_function	zinc ion binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	50.944
	SRR3591706	second leaf	87.356
	SRR3591707	mature leaf	39.437
	SRR3591708	Shoot apex	90.902
	SRR3591709	Stem	40.979
	SRR3591710	White floral bud	116.732
	SRR3591711	White flower	71.897
	SRR3591712	Green floral bud	153.934
	SRR3591713	Yellow flower	60.531
SRP173429	SRR8316895	Juvenile bud stage	35.763
	SRR8316896	Juvenile bud stage	35.945
	SRR8316897	Juvenile bud stage	27.770
	SRR8316894	Third green stage	27.158
	SRR8316900	Third green stage	99.300
	SRR8316901	Third green stage	118.919
	SRR8316898	Complete white stage	39.027
	SRR8316899	Complete white stage	141.584
	SRR8316903	Complete white stage	69.743
	SRR8316902	Silver flowering stage	27.678
	SRR8316904	Silver flowering stage	31.819
	SRR8316905	Silver flowering stage	17.847
	SRR8316906	Gold flowering stage	49.423
	SRR8316907	Gold flowering stage	57.552
	SRR8316908	Gold flowering stage	47.576
SRP132670	SRR6706286	Control	110.412
	SRR6706287	Light intensity 50%	123.327
	SRR6706288	Light intensity 20%	121.692
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	79.915
	CNS0095593	Slightly white alabastrum(diploid) 2	101.080
	CNS0095594	Slightly white alabastrum(diploid) 3	59.468
	CNS0095595	Whole white alabastrum(diploid) 2	71.655
	CNS0095596	Whole white alabastrum(diploid) 3	81.633
	CNS0095597	Whole white alabastrum(diploid) 4	66.057
	CNS0095598	Silvery flower (diploied) 1	86.986
	CNS0095599	Silvery flower (diploied) 2	73.055
	CNS0095600	Silvery flower (diploied) 3	80.573
	CNS0095601	Golden flower (diploid) 1	60.555
	CNS0095602	Golden flower (diploid) 2	82.194
	CNS0095603	Golden flower (diploid) 3	75.949
	CNS0095604	Slightly white alabastrum(tetraploid) 1	88.449
	CNS0095605	Slightly white alabastrum(tetraploid) 2	85.180
	CNS0095606	Slightly white alabastrum(tetraploid) 3	139.287
	CNS0095607	Whole white alabastrum(tetraploid) 1	48.375
	CNS0095608	Whole white alabastrum(tetraploid) 2	52.771
	CNS0095609	Whole white alabastrum(tetraploid) 3	86.563
	CNS0095610	Silvery flower (tetraploid) 1	68.050
	CNS0095611	Silvery flower (tetraploid) 2	69.507
	CNS0095612	Silvery flower (tetraploid) 3	41.054
	CNS0095613	Golden flower (tetraploid) 1	72.158
	CNS0095614	Golden flower (tetraploid) 2	79.768
	CNS0095615	Golden flower (tetraploid) 3	82.156
CRA001975	CRR073297	Stem 1	62.275
	CRR073298	Stem 2	65.313
	CRR073299	Stem 3	65.017
	CRR073300	Leaf 1	100.255
	CRR073301	Leaf 2	105.697
	CRR073302	Leaf 3	81.973
	CRR073303	Juvenile bud 1	82.042
	CRR073304	Juvenile bud 2	80.323
	CRR073305	Juvenile bud 3	116.905
	CRR073306	Third green 1	26.372
	CRR073307	Third green 2	35.963
	CRR073308	Third green 3	33.091
	CRR073309	Second white 1	13.750
	CRR073310	Second white 2	9.610
	CRR073311	Second white 3	8.150
	CRR073312	Silver flowering 1	13.384
	CRR073313	Silver flowering 2	14.960
	CRR073314	Silver flowering 3	13.853
	CRR073315	Gold flowering 1	52.662
	CRR073316	Gold flowering 2	71.758
	CRR073317	Gold flowering 3	74.317
	CRR073318	Tawny withering 1	39.957
	CRR073319	Tawny withering 2	59.805
	CRR073320	Tawny withering 3	40.089