Gene detail

Detail information of GWHGAAZE021942

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHZ35334.1	1.4049E-32	chlorophyllase [Picrorhiza kurrooa]
Swissprot	tr\|Q9M7I7\|CLH2_ARATH	2E-28	Chlorophyllase-2, chloroplastic (Precursor)
trEMBL	tr\|I1I435\|I1I435_BRADI	4E-33	Uncharacterized protein {ECO:0000313\|EnsemblPlants:BRADI3G26967.1}
TAIR10	AT5G43860.1	4E-24	chlorophyllase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	64433752	64435638	+
GWHAAZE00000006	mRNA	64433752	64435638	+
GWHAAZE00000006	exon	64433752	64434048	+
GWHAAZE00000006	exon	64435465	64435638	+
GWHAAZE00000006	CDS	64433752	64434048	+
GWHAAZE00000006	CDS	64435465	64435638	+

Transcript Sequence
>GWHTAAZE021968 ATGCCTCATTCTCCTTCATCTTCAACCTCTTCTTCTACTACTGTTACAACTAATGTATTTGAAATTGGAAAGTATCCAACAATTATTGTGAAATCTGAAGGAGAGAAATGTACAATTAAGCCTGCACAAGGTACAACAAGTGTTGCTCCTCCAAAGCCACTATTGATTGCCACACCAACAGAAGCAGGGGAGTACCCTGTAATATTGTTCCTCCATGGATATCTCTTAAATAATTCTTTTTACTCTCAGCTTCTTCTTCACATAGCTTCCCACGGCTTCATTGTCATTGCTCCCCAGTTATACTCCGTGGCAGGACCAGACACAACCGCGAAATCAAACCGCAGCCGCAATAACAAACTGGTTACCCGAAGGTCTCCCCACCTTGCTTCCCTCTCAAGTCCACCCAAACCTAGCCAAGCTAGCACTTGCTGGGCACAGCCGGGAGGCAAAGCCGCTTCGCACTATTGCTAA

Network for GWHGAAZE021942

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07224.12	Chlorophyllase	13	111	7.60E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08099	E3.1.1.14	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Porphyrin and chlorophyll metabolism	map00860

Gene Ontology

GO term	Ontology	Name
GO:0015996	biological_process	chlorophyll catabolic process
GO:0047746	molecular_function	chlorophyllase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.285
	SRR3591706	second leaf	2.867
	SRR3591707	mature leaf	2.570
	SRR3591708	Shoot apex	2.139
	SRR3591709	Stem	1.410
	SRR3591710	White floral bud	0.113
	SRR3591711	White flower	0.368
	SRR3591712	Green floral bud	0.702
	SRR3591713	Yellow flower	0.125
SRP173429	SRR8316895	Juvenile bud stage	0.834
	SRR8316896	Juvenile bud stage	0.563
	SRR8316897	Juvenile bud stage	0.057
	SRR8316894	Third green stage	0.180
	SRR8316900	Third green stage	0.626
	SRR8316901	Third green stage	0.511
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.224
	SRR8316903	Complete white stage	0.054
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.075
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.903
	SRR6706287	Light intensity 50%	1.264
	SRR6706288	Light intensity 20%	0.815
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.234
	CNS0095593	Slightly white alabastrum(diploid) 2	0.856
	CNS0095594	Slightly white alabastrum(diploid) 3	0.137
	CNS0095595	Whole white alabastrum(diploid) 2	0.184
	CNS0095596	Whole white alabastrum(diploid) 3	0.441
	CNS0095597	Whole white alabastrum(diploid) 4	0.330
	CNS0095598	Silvery flower (diploied) 1	1.097
	CNS0095599	Silvery flower (diploied) 2	0.302
	CNS0095600	Silvery flower (diploied) 3	0.112
	CNS0095601	Golden flower (diploid) 1	1.774
	CNS0095602	Golden flower (diploid) 2	0.352
	CNS0095603	Golden flower (diploid) 3	0.602
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.646
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.650
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.023
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.401
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.238
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.287
	CNS0095610	Silvery flower (tetraploid) 1	0.447
	CNS0095611	Silvery flower (tetraploid) 2	0.495
	CNS0095612	Silvery flower (tetraploid) 3	0.134
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.066
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.334
	CRR073298	Stem 2	1.496
	CRR073299	Stem 3	2.015
	CRR073300	Leaf 1	0.412
	CRR073301	Leaf 2	1.297
	CRR073302	Leaf 3	0.183
	CRR073303	Juvenile bud 1	0.153
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.146
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.024
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	15.927
	CRR073316	Gold flowering 2	14.914
	CRR073317	Gold flowering 3	14.750
	CRR073318	Tawny withering 1	2.743
	CRR073319	Tawny withering 2	1.297
	CRR073320	Tawny withering 3	2.507