Gene detail

Detail information of GWHGAAZE021946

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO74483.1	1.2937E-124	hypothetical protein CISIN_1g020950mg [Citrus sinensis]
COG	YP_003200998.1	0.00000001	chlorophyllase
Swissprot	tr\|Q9M7I7\|CLH2_ARATH	7E-104	Chlorophyllase-2, chloroplastic (Precursor)
trEMBL	tr\|A0A067G4F1\|A0A067G4F1_CITSI	5E-125	Uncharacterized protein {ECO:0000313\|EMBL:KDO74483.1}
TAIR10	AT5G43860.1	4E-84	chlorophyllase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	64530669	64531370	+
GWHAAZE00000006	mRNA	64530669	64531370	+
GWHAAZE00000006	exon	64530669	64531370	+
GWHAAZE00000006	CDS	64530669	64531370	+

Transcript Sequence
>GWHTAAZE021972 ATGCAACAGTTATACTCCGTGGCAGGACCAGACACAACCGGCGAAATCAAATCCGCAGCCGCAATAACAAACTGGTTACCCGAAGGTCTCCCCACCTTGCTTCCCTCTCAAGTCCACCCAAACCTAGCCAAGCTAGCACTTGCTGGGCACAGCCGGGGAGGCAAAGCCGCGTTCGCACTATTGCTAAAAAAATATGATACGCGTTTGAAGTTCTCAGCTCTGATAGGCATTGATCCAGTCGATGGCATGGACACAGGGAAACAGACACCACCTCCAGTCCTAACCTACACCCCTCGTTCCTTTGACCTCAACATGGCCGTTCTGGTGATTGGCTCAGGCCTGGGCGAGATCAAAAAGAACCCGTTGTTCCCACCTTGTGCACCTAAGGGGGTGAACCACGAGGACTTCTTTAATGAGTGCCGCAAGCCGGCTTGTTACTTTGTTGCTAAGGATTATGGGCATGTTGATATGTTGGATGATGAGACTAAGGGAGTGAGAGGGAAGGCTACTTATTGTTTGTGCAAAAATGGGAAGGCCAGAGAGCCCATGAGGAGGTTTGTTGGGGGGATTGTGGTTGCTTTTTTGATGGGTTATTTGGATGGGAATTTTGGGGATTTGGTGGCTATAAAAGAGAAGCATGAGTTGGTTCCTTTGGTGCTTCAAAGAGTTGAATTTCTTGATGAATCTTTGCAGTTACATTAG

Network for GWHGAAZE021946

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07224.12	Chlorophyllase	3	224	1.40E-90

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08099	E3.1.1.14	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Porphyrin and chlorophyll metabolism	map00860

Gene Ontology

GO term	Ontology	Name
GO:0015996	biological_process	chlorophyll catabolic process
GO:0047746	molecular_function	chlorophyllase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.247
	SRR3591706	second leaf	28.042
	SRR3591707	mature leaf	23.068
	SRR3591708	Shoot apex	22.272
	SRR3591709	Stem	9.966
	SRR3591710	White floral bud	1.260
	SRR3591711	White flower	2.033
	SRR3591712	Green floral bud	7.934
	SRR3591713	Yellow flower	0.141
SRP173429	SRR8316895	Juvenile bud stage	4.798
	SRR8316896	Juvenile bud stage	4.575
	SRR8316897	Juvenile bud stage	2.162
	SRR8316894	Third green stage	2.628
	SRR8316900	Third green stage	5.454
	SRR8316901	Third green stage	5.063
	SRR8316898	Complete white stage	0.179
	SRR8316899	Complete white stage	2.820
	SRR8316903	Complete white stage	0.609
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.015
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.180
	SRR8316907	Gold flowering stage	0.378
	SRR8316908	Gold flowering stage	1.459
SRP132670	SRR6706286	Control	4.694
	SRR6706287	Light intensity 50%	3.730
	SRR6706288	Light intensity 20%	2.764
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.176
	CNS0095593	Slightly white alabastrum(diploid) 2	4.174
	CNS0095594	Slightly white alabastrum(diploid) 3	0.856
	CNS0095595	Whole white alabastrum(diploid) 2	2.733
	CNS0095596	Whole white alabastrum(diploid) 3	3.898
	CNS0095597	Whole white alabastrum(diploid) 4	1.940
	CNS0095598	Silvery flower (diploied) 1	6.170
	CNS0095599	Silvery flower (diploied) 2	2.165
	CNS0095600	Silvery flower (diploied) 3	0.298
	CNS0095601	Golden flower (diploid) 1	3.259
	CNS0095602	Golden flower (diploid) 2	1.886
	CNS0095603	Golden flower (diploid) 3	1.625
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.563
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.898
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.540
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.347
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.161
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.718
	CNS0095610	Silvery flower (tetraploid) 1	0.539
	CNS0095611	Silvery flower (tetraploid) 2	1.247
	CNS0095612	Silvery flower (tetraploid) 3	1.072
	CNS0095613	Golden flower (tetraploid) 1	0.093
	CNS0095614	Golden flower (tetraploid) 2	0.230
	CNS0095615	Golden flower (tetraploid) 3	0.092
CRA001975	CRR073297	Stem 1	10.824
	CRR073298	Stem 2	9.447
	CRR073299	Stem 3	13.789
	CRR073300	Leaf 1	5.503
	CRR073301	Leaf 2	7.832
	CRR073302	Leaf 3	6.305
	CRR073303	Juvenile bud 1	2.903
	CRR073304	Juvenile bud 2	1.134
	CRR073305	Juvenile bud 3	2.955
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.251
	CRR073308	Third green 3	0.217
	CRR073309	Second white 1	0.141
	CRR073310	Second white 2	0.097
	CRR073311	Second white 3	0.395
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.047
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	65.486
	CRR073316	Gold flowering 2	60.304
	CRR073317	Gold flowering 3	61.826
	CRR073318	Tawny withering 1	16.020
	CRR073319	Tawny withering 2	8.695
	CRR073320	Tawny withering 3	14.552