Gene detail

Detail information of GWHGAAZE021964

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011091067.1	1.51189E-96	PREDICTED: calmodulin-like protein 11 [Sesamum indicum]
COG	YP_001866396.1	3E-32	signal transduction protein
Swissprot	tr\|Q9LIK5\|CML11_ARATH	3E-86	Calmodulin-like protein 11
trEMBL	tr\|M5XFI3\|M5XFI3_PRUPE	2E-94	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24877.1}
TAIR10	AT3G22930.1	3E-68	calmodulin-like 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	64830128	64833730	+
GWHAAZE00000006	mRNA	64830128	64833730	+
GWHAAZE00000006	exon	64830128	64830203	+
GWHAAZE00000006	exon	64830373	64830530	+
GWHAAZE00000006	exon	64832436	64832516	+
GWHAAZE00000006	exon	64833593	64833730	+
GWHAAZE00000006	CDS	64830128	64830203	+
GWHAAZE00000006	CDS	64830373	64830530	+
GWHAAZE00000006	CDS	64832436	64832516	+
GWHAAZE00000006	CDS	64833593	64833730	+

Transcript Sequence
>GWHTAAZE021990 ATGGCAGATATATTGAATGAAGAACAGATTGTTGAGTTTCAAGAGGCATTTAGTTTATTTGATAAAGATGGAGATGGTTGCATTACGGTGGACGAATTGGCGACGGTGATAAGGTCGTTGGATCAAAATCCAACAGAGGAAGAACTTCAAGACATGATTAATGAAGTTGATACTGATGGAAATGGTACCATTGAATTTGTTGAGTTCTTGAACCTCATGGCCAGAAAAATGAAGGAGACTGATGCAGAGGAGGAGCTCAAAGAAGCTTTCAAAGTGTTTGACAAGGATCAAAACGGTTATATATCAGCCAATGAGCTGCGGCACGTGATGATCAATCTAGGTGAGAAACTAACCGATGATGAAGTGGAACAGATGATTAGGGAGGCTGATTTGGACGGTGATGGGCAAGTCAACTATGATGAATTCGTCAAGATGATGATGACCATTGGATAA

Network for GWHGAAZE021964

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	13	73	2.60E-16
PF13499.7	EF-hand_7	83	146	3.80E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.308
	SRR3591706	second leaf	0.779
	SRR3591707	mature leaf	1.661
	SRR3591708	Shoot apex	0.233
	SRR3591709	Stem	3.305
	SRR3591710	White floral bud	1.233
	SRR3591711	White flower	1.387
	SRR3591712	Green floral bud	2.403
	SRR3591713	Yellow flower	0.349
SRP173429	SRR8316895	Juvenile bud stage	3.969
	SRR8316896	Juvenile bud stage	2.394
	SRR8316897	Juvenile bud stage	5.036
	SRR8316894	Third green stage	0.992
	SRR8316900	Third green stage	0.646
	SRR8316901	Third green stage	1.514
	SRR8316898	Complete white stage	0.323
	SRR8316899	Complete white stage	1.652
	SRR8316903	Complete white stage	0.421
	SRR8316902	Silver flowering stage	0.417
	SRR8316904	Silver flowering stage	0.523
	SRR8316905	Silver flowering stage	0.219
	SRR8316906	Gold flowering stage	2.673
	SRR8316907	Gold flowering stage	2.041
	SRR8316908	Gold flowering stage	2.018
SRP132670	SRR6706286	Control	5.445
	SRR6706287	Light intensity 50%	3.639
	SRR6706288	Light intensity 20%	2.475
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.256
	CNS0095593	Slightly white alabastrum(diploid) 2	4.730
	CNS0095594	Slightly white alabastrum(diploid) 3	4.615
	CNS0095595	Whole white alabastrum(diploid) 2	1.532
	CNS0095596	Whole white alabastrum(diploid) 3	0.180
	CNS0095597	Whole white alabastrum(diploid) 4	1.693
	CNS0095598	Silvery flower (diploied) 1	0.312
	CNS0095599	Silvery flower (diploied) 2	2.150
	CNS0095600	Silvery flower (diploied) 3	0.595
	CNS0095601	Golden flower (diploid) 1	2.155
	CNS0095602	Golden flower (diploid) 2	0.889
	CNS0095603	Golden flower (diploid) 3	1.932
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.363
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.385
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.154
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.155
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.039
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.152
	CNS0095610	Silvery flower (tetraploid) 1	0.145
	CNS0095611	Silvery flower (tetraploid) 2	0.001
	CNS0095612	Silvery flower (tetraploid) 3	0.003
	CNS0095613	Golden flower (tetraploid) 1	0.372
	CNS0095614	Golden flower (tetraploid) 2	0.327
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	5.853
	CRR073298	Stem 2	2.596
	CRR073299	Stem 3	0.498
	CRR073300	Leaf 1	0.579
	CRR073301	Leaf 2	3.567
	CRR073302	Leaf 3	0.856
	CRR073303	Juvenile bud 1	0.001
	CRR073304	Juvenile bud 2	0.322
	CRR073305	Juvenile bud 3	2.609
	CRR073306	Third green 1	0.642
	CRR073307	Third green 2	0.132
	CRR073308	Third green 3	0.624
	CRR073309	Second white 1	0.001
	CRR073310	Second white 2	0.040
	CRR073311	Second white 3	0.459
	CRR073312	Silver flowering 1	0.725
	CRR073313	Silver flowering 2	0.405
	CRR073314	Silver flowering 3	1.048
	CRR073315	Gold flowering 1	2.456
	CRR073316	Gold flowering 2	5.031
	CRR073317	Gold flowering 3	2.134
	CRR073318	Tawny withering 1	8.016
	CRR073319	Tawny withering 2	7.366
	CRR073320	Tawny withering 3	4.384