Gene detail

Detail information of GWHGAAZE021970

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011091067.1	1.51189E-96	PREDICTED: calmodulin-like protein 11 [Sesamum indicum]
COG	YP_001866396.1	3E-32	signal transduction protein
Swissprot	tr\|Q9LIK5\|CML11_ARATH	3E-86	Calmodulin-like protein 11
trEMBL	tr\|M5XFI3\|M5XFI3_PRUPE	2E-94	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24877.1}
TAIR10	AT3G22930.1	3E-68	calmodulin-like 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	64969114	64972701	+
GWHAAZE00000006	mRNA	64969114	64972701	+
GWHAAZE00000006	exon	64969114	64969189	+
GWHAAZE00000006	exon	64969359	64969516	+
GWHAAZE00000006	exon	64971413	64971493	+
GWHAAZE00000006	exon	64972564	64972701	+
GWHAAZE00000006	CDS	64969114	64969189	+
GWHAAZE00000006	CDS	64969359	64969516	+
GWHAAZE00000006	CDS	64971413	64971493	+
GWHAAZE00000006	CDS	64972564	64972701	+

Transcript Sequence
>GWHTAAZE021996 ATGGCAGATATATTGAATGAAGAACAGATTGTTGAGTTTCAAGAGGCATTTAGTTTATTTGATAAAGATGGAGATGGTTGCATTACGGTGGACGAATTGGCGACGGTGATAAGGTCGTTGGATCAAAATCCAACAGAGGAAGAACTTCAAGACATGATTAATGAAGTTGATACTGATGGAAATGGTACCATTGAATTTGTTGAGTTCTTGAACCTCATGGCCAGAAAAATGAAGGAGACTGATGCAGAGGAGGAGCTCAAAGAAGCTTTCAAAGTGTTTGACAAGGATCAAAACGGTTATATATCAGCCAATGAGCTGCGGCACGTGATGATCAATCTAGGTGAGAAACTAACCGATGATGAAGTGGAACAGATGATTAGGGAGGCTGATTTGGACGGTGATGGGCAAGTCAACTATGATGAATTCGTCAAGATGATGATGACCATTGGATAA

Network for GWHGAAZE021970

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	13	73	2.60E-16
PF13499.7	EF-hand_7	83	146	3.80E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.452
	SRR3591706	second leaf	0.860
	SRR3591707	mature leaf	1.896
	SRR3591708	Shoot apex	0.772
	SRR3591709	Stem	3.229
	SRR3591710	White floral bud	1.653
	SRR3591711	White flower	1.457
	SRR3591712	Green floral bud	2.272
	SRR3591713	Yellow flower	0.203
SRP173429	SRR8316895	Juvenile bud stage	3.589
	SRR8316896	Juvenile bud stage	6.370
	SRR8316897	Juvenile bud stage	3.943
	SRR8316894	Third green stage	1.060
	SRR8316900	Third green stage	0.804
	SRR8316901	Third green stage	1.560
	SRR8316898	Complete white stage	0.515
	SRR8316899	Complete white stage	2.203
	SRR8316903	Complete white stage	0.431
	SRR8316902	Silver flowering stage	0.289
	SRR8316904	Silver flowering stage	0.529
	SRR8316905	Silver flowering stage	0.453
	SRR8316906	Gold flowering stage	3.000
	SRR8316907	Gold flowering stage	0.537
	SRR8316908	Gold flowering stage	5.665
SRP132670	SRR6706286	Control	1.379
	SRR6706287	Light intensity 50%	4.001
	SRR6706288	Light intensity 20%	2.532
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.692
	CNS0095593	Slightly white alabastrum(diploid) 2	5.027
	CNS0095594	Slightly white alabastrum(diploid) 3	2.052
	CNS0095595	Whole white alabastrum(diploid) 2	2.859
	CNS0095596	Whole white alabastrum(diploid) 3	0.183
	CNS0095597	Whole white alabastrum(diploid) 4	1.388
	CNS0095598	Silvery flower (diploied) 1	0.472
	CNS0095599	Silvery flower (diploied) 2	2.208
	CNS0095600	Silvery flower (diploied) 3	0.526
	CNS0095601	Golden flower (diploid) 1	2.082
	CNS0095602	Golden flower (diploid) 2	1.189
	CNS0095603	Golden flower (diploid) 3	0.418
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.353
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.474
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.623
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.139
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.033
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.152
	CNS0095610	Silvery flower (tetraploid) 1	0.052
	CNS0095611	Silvery flower (tetraploid) 2	0.002
	CNS0095612	Silvery flower (tetraploid) 3	0.003
	CNS0095613	Golden flower (tetraploid) 1	0.327
	CNS0095614	Golden flower (tetraploid) 2	0.411
	CNS0095615	Golden flower (tetraploid) 3	0.130
CRA001975	CRR073297	Stem 1	5.929
	CRR073298	Stem 2	2.574
	CRR073299	Stem 3	0.493
	CRR073300	Leaf 1	3.052
	CRR073301	Leaf 2	3.298
	CRR073302	Leaf 3	0.727
	CRR073303	Juvenile bud 1	0.001
	CRR073304	Juvenile bud 2	0.319
	CRR073305	Juvenile bud 3	0.555
	CRR073306	Third green 1	1.303
	CRR073307	Third green 2	0.132
	CRR073308	Third green 3	1.489
	CRR073309	Second white 1	0.001
	CRR073310	Second white 2	0.912
	CRR073311	Second white 3	0.465
	CRR073312	Silver flowering 1	0.642
	CRR073313	Silver flowering 2	0.405
	CRR073314	Silver flowering 3	0.840
	CRR073315	Gold flowering 1	1.983
	CRR073316	Gold flowering 2	4.735
	CRR073317	Gold flowering 3	1.783
	CRR073318	Tawny withering 1	7.858
	CRR073319	Tawny withering 2	11.820
	CRR073320	Tawny withering 3	4.678