Gene detail

Detail information of GWHGAAZE022251

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008463180.1	5.83504E-72	PREDICTED: eukaryotic translation initiation factor 3 subunit J-like [Cucumis melo]
trEMBL	tr\|A0A059BT92\|A0A059BT92_EUCGR	5E-72	Eukaryotic translation initiation factor 3 subunit J {ECO:0000256\|HAMAP-Rule:MF_03009}
TAIR10	AT1G66070.2	2E-40	Translation initiation factor eIF3 subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	69195964	69196793	+
GWHAAZE00000006	mRNA	69195964	69196793	+
GWHAAZE00000006	exon	69195964	69196118	+
GWHAAZE00000006	exon	69196349	69196496	+
GWHAAZE00000006	exon	69196593	69196793	+
GWHAAZE00000006	CDS	69195964	69196118	+
GWHAAZE00000006	CDS	69196349	69196496	+
GWHAAZE00000006	CDS	69196593	69196793	+

Transcript Sequence
>GWHTAAZE022279 ATGTTATTGTGTAATCATCAGGCACCTGCTGCTCCACCTGCCGAGAAGGCCCCAAAGAAGTCCACAACGAAATCTCATGATAAGAAAGGAAAAGCTGTTGAAGTTGCGCCAGCTGTGCCATTGGATCCTGTAGCAGAAAAACTTCGACAACAAAGGCTGGTCGAGGAAGCAGACTATAAACACACTACCGACCTGTTTGCTAAGAAGGGAGATGAGAAGTCCCTTGATAATTTCATTCCCAAATCAGAAAGTGACTTCGTAGAATATGCAGAGCTCATATCTCACAAGCTTCGGCCATATGAGAAAAGCTTCCATTATATTGGATTGCTGAAGGCTGTAATGAGACTGTCCATGACTTCTCTCAAAGCGTCAGATGCAAAAGAAGTTGCGTCTTCTGTTACTGCCATTGCAAACGAGAAGCTAAAAGCGGAGAAAGAAGCCAATGCCGGTAAAAAGAAGACAGGTATGCACTTTTCACCTCCCTGTTTTGTTACTTGCGTCTAG

Network for GWHGAAZE022251

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08597.11	eIF3_subunit	9	154	9.60E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03245	EIF3J	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name
GO:0005737	cellular_component	cytoplasm
GO:0005852	cellular_component	eukaryotic translation initiation factor 3 complex
GO:0003743	molecular_function	translation initiation factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.938
	SRR3591706	second leaf	30.774
	SRR3591707	mature leaf	21.944
	SRR3591708	Shoot apex	34.834
	SRR3591709	Stem	53.411
	SRR3591710	White floral bud	53.062
	SRR3591711	White flower	61.699
	SRR3591712	Green floral bud	78.268
	SRR3591713	Yellow flower	77.364
SRP173429	SRR8316895	Juvenile bud stage	39.288
	SRR8316896	Juvenile bud stage	49.841
	SRR8316897	Juvenile bud stage	25.256
	SRR8316894	Third green stage	20.979
	SRR8316900	Third green stage	87.005
	SRR8316901	Third green stage	77.656
	SRR8316898	Complete white stage	40.984
	SRR8316899	Complete white stage	116.784
	SRR8316903	Complete white stage	56.321
	SRR8316902	Silver flowering stage	36.238
	SRR8316904	Silver flowering stage	41.251
	SRR8316905	Silver flowering stage	19.984
	SRR8316906	Gold flowering stage	78.054
	SRR8316907	Gold flowering stage	73.968
	SRR8316908	Gold flowering stage	69.219
SRP132670	SRR6706286	Control	45.857
	SRR6706287	Light intensity 50%	51.364
	SRR6706288	Light intensity 20%	51.157
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	56.454
	CNS0095593	Slightly white alabastrum(diploid) 2	59.613
	CNS0095594	Slightly white alabastrum(diploid) 3	46.241
	CNS0095595	Whole white alabastrum(diploid) 2	57.611
	CNS0095596	Whole white alabastrum(diploid) 3	57.442
	CNS0095597	Whole white alabastrum(diploid) 4	50.760
	CNS0095598	Silvery flower (diploied) 1	46.193
	CNS0095599	Silvery flower (diploied) 2	34.129
	CNS0095600	Silvery flower (diploied) 3	66.542
	CNS0095601	Golden flower (diploid) 1	40.658
	CNS0095602	Golden flower (diploid) 2	67.733
	CNS0095603	Golden flower (diploid) 3	61.497
	CNS0095604	Slightly white alabastrum(tetraploid) 1	57.404
	CNS0095605	Slightly white alabastrum(tetraploid) 2	51.566
	CNS0095606	Slightly white alabastrum(tetraploid) 3	63.125
	CNS0095607	Whole white alabastrum(tetraploid) 1	48.652
	CNS0095608	Whole white alabastrum(tetraploid) 2	49.432
	CNS0095609	Whole white alabastrum(tetraploid) 3	63.803
	CNS0095610	Silvery flower (tetraploid) 1	69.232
	CNS0095611	Silvery flower (tetraploid) 2	46.131
	CNS0095612	Silvery flower (tetraploid) 3	52.606
	CNS0095613	Golden flower (tetraploid) 1	52.235
	CNS0095614	Golden flower (tetraploid) 2	71.275
	CNS0095615	Golden flower (tetraploid) 3	45.295
CRA001975	CRR073297	Stem 1	63.460
	CRR073298	Stem 2	68.140
	CRR073299	Stem 3	71.193
	CRR073300	Leaf 1	78.689
	CRR073301	Leaf 2	80.163
	CRR073302	Leaf 3	85.562
	CRR073303	Juvenile bud 1	111.011
	CRR073304	Juvenile bud 2	106.590
	CRR073305	Juvenile bud 3	96.768
	CRR073306	Third green 1	66.473
	CRR073307	Third green 2	70.955
	CRR073308	Third green 3	66.023
	CRR073309	Second white 1	48.077
	CRR073310	Second white 2	46.963
	CRR073311	Second white 3	43.052
	CRR073312	Silver flowering 1	43.024
	CRR073313	Silver flowering 2	48.275
	CRR073314	Silver flowering 3	52.719
	CRR073315	Gold flowering 1	26.168
	CRR073316	Gold flowering 2	33.045
	CRR073317	Gold flowering 3	31.672
	CRR073318	Tawny withering 1	68.330
	CRR073319	Tawny withering 2	67.497
	CRR073320	Tawny withering 3	66.049