Gene detail

Detail information of GWHGAAZE022284

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011003162.1	8.4939E-110	PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Populus euphratica]
COG	YP_004104012.1	3E-37	ubiquitin
Swissprot	tr\|P62981\|RS27A_SOLTU	4E-110	40S ribosomal protein S27a (Precursor)
trEMBL	tr\|A0A058ZUJ2\|A0A058ZUJ2_EUCGR	5E-110	Uncharacterized protein {ECO:0000313\|EMBL:KCW45422.1}
TAIR10	AT2G47110.2	1E-68	ubiquitin 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	69896607	69897077	+
GWHAAZE00000006	mRNA	69896607	69897077	+
GWHAAZE00000006	exon	69896607	69897077	+
GWHAAZE00000006	CDS	69896607	69897077	+

Transcript Sequence
>GWHTAAZE022314 ATGCAGATCTTCGTCAAAACCCTAACCGGGAAGACCATAACCCTAGAGGTTGAGTCCTCCGACACAATCGACAATGTCAAGGCCAAAATCCAGGACAAGGAAGGGATACCGCCCGACCAGCAACGGCTCATCTTCGCCGGAAAACAGCTGGAGGACGGTAGAACCCTAGCCGACTACAACATCCAGAAGGAGTCGACGCTCCACTTGGTCCTCCGTCTCCGCGGCGGAGCGAAGAAGAGGAAGAAGAAGACTTACACCAAGCCTAAGAAAATCAAGCACAAGAAGAAGAAGGTGAAGCTTGCGGTGTTGCAATTTTACAAAGTTGATGATTCTGGTAAGGTTCAGAGGCTGAGGAAGGAGTGTCCTAACGGTGAGTGTGGTGCTGGTACTTTCATGGCGAATCATTTTGACCGTCATTACTGTGGTAAGTGTGGGCTCACTTACGTTTACCAGAAGGCCGGTGGTGATTGA

Network for GWHGAAZE022284

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00240.24	ubiquitin	3	74	6.10E-34
PF01599.20	Ribosomal_S27	102	147	2.30E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02977	RP-S27Ae, RPS27A, UBA80	Ribosome	map03010
		Ubiquitin mediated proteolysis	map04120
		Mitophagy - animal	map04137

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	369.317
	SRR3591706	second leaf	178.175
	SRR3591707	mature leaf	98.406
	SRR3591708	Shoot apex	515.986
	SRR3591709	Stem	194.305
	SRR3591710	White floral bud	142.541
	SRR3591711	White flower	147.698
	SRR3591712	Green floral bud	330.377
	SRR3591713	Yellow flower	70.279
SRP173429	SRR8316895	Juvenile bud stage	228.843
	SRR8316896	Juvenile bud stage	291.681
	SRR8316897	Juvenile bud stage	154.945
	SRR8316894	Third green stage	113.153
	SRR8316900	Third green stage	397.281
	SRR8316901	Third green stage	387.651
	SRR8316898	Complete white stage	57.717
	SRR8316899	Complete white stage	307.480
	SRR8316903	Complete white stage	97.017
	SRR8316902	Silver flowering stage	48.115
	SRR8316904	Silver flowering stage	52.234
	SRR8316905	Silver flowering stage	28.471
	SRR8316906	Gold flowering stage	66.384
	SRR8316907	Gold flowering stage	70.981
	SRR8316908	Gold flowering stage	69.638
SRP132670	SRR6706286	Control	551.282
	SRR6706287	Light intensity 50%	557.558
	SRR6706288	Light intensity 20%	600.851
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	388.886
	CNS0095593	Slightly white alabastrum(diploid) 2	497.172
	CNS0095594	Slightly white alabastrum(diploid) 3	405.043
	CNS0095595	Whole white alabastrum(diploid) 2	359.622
	CNS0095596	Whole white alabastrum(diploid) 3	441.730
	CNS0095597	Whole white alabastrum(diploid) 4	317.511
	CNS0095598	Silvery flower (diploied) 1	194.657
	CNS0095599	Silvery flower (diploied) 2	172.624
	CNS0095600	Silvery flower (diploied) 3	122.052
	CNS0095601	Golden flower (diploid) 1	159.233
	CNS0095602	Golden flower (diploid) 2	134.425
	CNS0095603	Golden flower (diploid) 3	123.825
	CNS0095604	Slightly white alabastrum(tetraploid) 1	367.625
	CNS0095605	Slightly white alabastrum(tetraploid) 2	389.845
	CNS0095606	Slightly white alabastrum(tetraploid) 3	409.999
	CNS0095607	Whole white alabastrum(tetraploid) 1	199.521
	CNS0095608	Whole white alabastrum(tetraploid) 2	187.654
	CNS0095609	Whole white alabastrum(tetraploid) 3	312.206
	CNS0095610	Silvery flower (tetraploid) 1	97.022
	CNS0095611	Silvery flower (tetraploid) 2	118.112
	CNS0095612	Silvery flower (tetraploid) 3	67.468
	CNS0095613	Golden flower (tetraploid) 1	61.945
	CNS0095614	Golden flower (tetraploid) 2	73.251
	CNS0095615	Golden flower (tetraploid) 3	46.369
CRA001975	CRR073297	Stem 1	379.384
	CRR073298	Stem 2	413.508
	CRR073299	Stem 3	564.279
	CRR073300	Leaf 1	389.959
	CRR073301	Leaf 2	455.298
	CRR073302	Leaf 3	724.723
	CRR073303	Juvenile bud 1	541.915
	CRR073304	Juvenile bud 2	417.318
	CRR073305	Juvenile bud 3	402.086
	CRR073306	Third green 1	93.893
	CRR073307	Third green 2	121.171
	CRR073308	Third green 3	104.773
	CRR073309	Second white 1	78.719
	CRR073310	Second white 2	57.781
	CRR073311	Second white 3	34.596
	CRR073312	Silver flowering 1	45.609
	CRR073313	Silver flowering 2	59.752
	CRR073314	Silver flowering 3	40.062
	CRR073315	Gold flowering 1	247.772
	CRR073316	Gold flowering 2	235.662
	CRR073317	Gold flowering 3	259.561
	CRR073318	Tawny withering 1	504.841
	CRR073319	Tawny withering 2	415.859
	CRR073320	Tawny withering 3	506.704