Gene detail

Detail information of GWHGAAZE022285

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009612739.1	5.552E-131	PREDICTED: 1-Cys peroxiredoxin [Nicotiana tomentosiformis]
COG	YP_005059276.1	1E-73	peroxidase
Swissprot	tr\|Q6E2Z6\|REHY_MEDTR	6E-125	1-Cys peroxiredoxin
trEMBL	tr\|K4BJ26\|K4BJ26_SOLLC	2E-129	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc03g096040.2.1}
TAIR10	AT1G48130.1	1E-90	1-cysteine peroxiredoxin 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	69907281	69908415	+
GWHAAZE00000006	mRNA	69907281	69908415	+
GWHAAZE00000006	exon	69907281	69907398	+
GWHAAZE00000006	exon	69907525	69907673	+
GWHAAZE00000006	exon	69907904	69908050	+
GWHAAZE00000006	exon	69908170	69908415	+
GWHAAZE00000006	CDS	69907281	69907398	+
GWHAAZE00000006	CDS	69907525	69907673	+
GWHAAZE00000006	CDS	69907904	69908050	+
GWHAAZE00000006	CDS	69908170	69908415	+

Transcript Sequence
>GWHTAAZE022315 ATGCCAGGGCTCACCATCGGAGACACCGTCCCGAACCTCGATGTTCAAACCACCCACGGCAAGATCAATCTCCATCAATATGTTGCTAATTCATACACCATCCTCTTCTCTCACCCAGGTGATTTTACCCCAGTGTGTACTACTGAACTTGGTGCAATGGCTGTTTATGCCGACAAGTTTGCACAGAGAGGAGCTAAGCTTTTGGGGTTGTCTTGTGATGACATCCAGTCTCACGTTGAGTGGATCAAGGACATTGAAGCCTATAACTCGGGGCACAAGGTTACGTACCCGATCATAGCAGATCCAAACAGGGAGATTATCAAGCAACTCAACATGGTGGACCCAGATGAAAAAGACTCCTCCAGGAGCCAGGTCCCATCTCGCGCTCTTCATATTGTGGGGCCCGATAAGAAGATTAAGCTGAGCTTTTTGTACCCGGCGAGTACTGGGAGAAACATGGACGAAGTGGTGAGGGTGTTGGATTCACTGCAGAAGGCGGCCAAGCACAAGGTTGCAACTCCGGTGAACTGGAGACAGGGAGAACAGGTGGTCATCTCTCCGAATGTGTCCGGTGATCAGGCAAAGGAGATGTTTCCCCAGGGGTACAAAACGGTCGACATGCCTTCCAAGAAGGAATTCCTGCGATTCACCAACGTTTAA

Network for GWHGAAZE022285

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00578.22	AhpC-TSA	6	140	1.20E-28
PF10417.10	1-cysPrx_C	162	201	1.10E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11188	PRDX6	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glutathione metabolism	map00480
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0045454	biological_process	cell redox homeostasis
GO:0016209	molecular_function	antioxidant activity
GO:0016491	molecular_function	oxidoreductase activity
GO:0051920	molecular_function	peroxiredoxin activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.637
	SRR3591706	second leaf	6.140
	SRR3591707	mature leaf	2.826
	SRR3591708	Shoot apex	1.381
	SRR3591709	Stem	3.499
	SRR3591710	White floral bud	4.615
	SRR3591711	White flower	1.075
	SRR3591712	Green floral bud	1.058
	SRR3591713	Yellow flower	0.067
SRP173429	SRR8316895	Juvenile bud stage	4.876
	SRR8316896	Juvenile bud stage	9.544
	SRR8316897	Juvenile bud stage	4.459
	SRR8316894	Third green stage	2.569
	SRR8316900	Third green stage	2.373
	SRR8316901	Third green stage	4.972
	SRR8316898	Complete white stage	0.840
	SRR8316899	Complete white stage	0.951
	SRR8316903	Complete white stage	0.721
	SRR8316902	Silver flowering stage	0.396
	SRR8316904	Silver flowering stage	0.097
	SRR8316905	Silver flowering stage	0.220
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.076
SRP132670	SRR6706286	Control	1.162
	SRR6706287	Light intensity 50%	1.188
	SRR6706288	Light intensity 20%	0.651
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.991
	CNS0095593	Slightly white alabastrum(diploid) 2	4.758
	CNS0095594	Slightly white alabastrum(diploid) 3	10.312
	CNS0095595	Whole white alabastrum(diploid) 2	2.381
	CNS0095596	Whole white alabastrum(diploid) 3	3.249
	CNS0095597	Whole white alabastrum(diploid) 4	0.533
	CNS0095598	Silvery flower (diploied) 1	0.139
	CNS0095599	Silvery flower (diploied) 2	0.493
	CNS0095600	Silvery flower (diploied) 3	1.334
	CNS0095601	Golden flower (diploid) 1	0.326
	CNS0095602	Golden flower (diploid) 2	0.542
	CNS0095603	Golden flower (diploid) 3	0.165
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.137
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.665
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.445
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.573
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.400
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.105
	CNS0095610	Silvery flower (tetraploid) 1	0.407
	CNS0095611	Silvery flower (tetraploid) 2	0.665
	CNS0095612	Silvery flower (tetraploid) 3	0.214
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	4.368
	CRR073298	Stem 2	3.551
	CRR073299	Stem 3	4.817
	CRR073300	Leaf 1	1.053
	CRR073301	Leaf 2	4.679
	CRR073302	Leaf 3	1.619
	CRR073303	Juvenile bud 1	1.649
	CRR073304	Juvenile bud 2	1.699
	CRR073305	Juvenile bud 3	1.937
	CRR073306	Third green 1	13.050
	CRR073307	Third green 2	9.494
	CRR073308	Third green 3	6.955
	CRR073309	Second white 1	1.705
	CRR073310	Second white 2	0.151
	CRR073311	Second white 3	0.099
	CRR073312	Silver flowering 1	0.304
	CRR073313	Silver flowering 2	0.105
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	3.917
	CRR073316	Gold flowering 2	4.923
	CRR073317	Gold flowering 3	3.954
	CRR073318	Tawny withering 1	0.641
	CRR073319	Tawny withering 2	1.088
	CRR073320	Tawny withering 3	2.075