Gene detail

Detail information of GWHGAAZE022351

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002534313.1	7.3082E-112	protein-s isoprenylcysteine O-methyltransferase, putative [Ricinus communis]
COG	YP_001526031.1	4E-13	isoprenylcysteine carboxyl methyltransferase
Swissprot	tr\|Q93W54\|ICMTB_ARATH	5E-100	Protein-S-isoprenylcysteine O-methyltransferase B
trEMBL	tr\|B9T7U4\|B9T7U4_RICCO	3E-112	Protein-s isoprenylcysteine O-methyltransferase, putative {ECO:0000313\|EMBL:EEF28069.1}
TAIR10	AT5G08335.1	3E-74	Isoprenylcysteine carboxyl methyltransferase (ICMT) family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	70884905	70885495	-
GWHAAZE00000006	mRNA	70884905	70885495	-
GWHAAZE00000006	exon	70884905	70885495	-
GWHAAZE00000006	CDS	70884905	70885495	-

Transcript Sequence
>GWHTAAZE022381 ATGACAGAAATCATCACCTACACAGCTTGCAGACAGTTGCTGCAAATTTTATTCGCTATATTCTTCTTTCATGCTTCTGAATACATTCTAGCACTTGCCATTCATGGATCAAATGTAACACTTAGGTCTCTTTTGATCAGCAAAAATTATCTCCTCGCAATGATTCTTTCACTGGTAGAATACTTGGTTGAAATTTACTTTTTTCCTGGGCTGAAGGAGCACTGGTGGATAAGCAATGTAGGCCTTGCAATGGTAATCATTGGGGAATTCATTCGAAAATTGGCCATTCTAACAGCTGGTCAAGCCTTCACTCATCTTATTAAAACATATCATGAGGAGCACCACAAATTGGTTACTCATGGCGTGTATAGATTAGTTCGTCATCCAGGATATTGCGGTTTCTTTGTCTGGTCAATTGGTACTCAAATAATGCTATGTAATCCAATATCCACGGTCGCATTTGCGTTGGTTGTTTGGCGCTTTTTCTCAGAACGGATACCATACGAAGAGTATTTCTTGAGGCGGTTTTTTGGGTCACAATACGACGATTACGCAGCACAGGTTCCTTCTGGGGTCCCCTTTGTTAGATGA

Network for GWHGAAZE022351

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04140.15	ICMT	82	173	4.20E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00587	ICMT, STE14	Biosynthesis of secondary metabolites	map01110
K00587	ICMT, STE14	Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0006481	biological_process	C-terminal protein methylation
GO:0016021	cellular_component	integral component of membrane
GO:0005783	cellular_component	endoplasmic reticulum
GO:0004671	molecular_function	protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.201
	SRR3591706	second leaf	2.546
	SRR3591707	mature leaf	3.205
	SRR3591708	Shoot apex	6.006
	SRR3591709	Stem	4.853
	SRR3591710	White floral bud	7.478
	SRR3591711	White flower	7.397
	SRR3591712	Green floral bud	11.632
	SRR3591713	Yellow flower	5.558
SRP173429	SRR8316895	Juvenile bud stage	4.001
	SRR8316896	Juvenile bud stage	7.600
	SRR8316897	Juvenile bud stage	1.830
	SRR8316894	Third green stage	3.244
	SRR8316900	Third green stage	9.576
	SRR8316901	Third green stage	10.093
	SRR8316898	Complete white stage	4.015
	SRR8316899	Complete white stage	13.900
	SRR8316903	Complete white stage	10.872
	SRR8316902	Silver flowering stage	3.963
	SRR8316904	Silver flowering stage	5.611
	SRR8316905	Silver flowering stage	2.245
	SRR8316906	Gold flowering stage	10.298
	SRR8316907	Gold flowering stage	7.881
	SRR8316908	Gold flowering stage	4.708
SRP132670	SRR6706286	Control	6.975
	SRR6706287	Light intensity 50%	7.036
	SRR6706288	Light intensity 20%	7.519
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.486
	CNS0095593	Slightly white alabastrum(diploid) 2	4.984
	CNS0095594	Slightly white alabastrum(diploid) 3	6.217
	CNS0095595	Whole white alabastrum(diploid) 2	5.117
	CNS0095596	Whole white alabastrum(diploid) 3	7.178
	CNS0095597	Whole white alabastrum(diploid) 4	4.393
	CNS0095598	Silvery flower (diploied) 1	5.198
	CNS0095599	Silvery flower (diploied) 2	5.297
	CNS0095600	Silvery flower (diploied) 3	6.944
	CNS0095601	Golden flower (diploid) 1	3.451
	CNS0095602	Golden flower (diploid) 2	4.433
	CNS0095603	Golden flower (diploid) 3	5.222
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.653
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.453
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.198
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.325
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.390
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.212
	CNS0095610	Silvery flower (tetraploid) 1	7.772
	CNS0095611	Silvery flower (tetraploid) 2	7.163
	CNS0095612	Silvery flower (tetraploid) 3	11.105
	CNS0095613	Golden flower (tetraploid) 1	4.892
	CNS0095614	Golden flower (tetraploid) 2	8.006
	CNS0095615	Golden flower (tetraploid) 3	6.218
CRA001975	CRR073297	Stem 1	4.919
	CRR073298	Stem 2	4.917
	CRR073299	Stem 3	2.937
	CRR073300	Leaf 1	6.997
	CRR073301	Leaf 2	6.246
	CRR073302	Leaf 3	2.815
	CRR073303	Juvenile bud 1	5.097
	CRR073304	Juvenile bud 2	4.167
	CRR073305	Juvenile bud 3	3.317
	CRR073306	Third green 1	2.738
	CRR073307	Third green 2	1.299
	CRR073308	Third green 3	3.536
	CRR073309	Second white 1	5.438
	CRR073310	Second white 2	5.433
	CRR073311	Second white 3	3.802
	CRR073312	Silver flowering 1	3.658
	CRR073313	Silver flowering 2	4.515
	CRR073314	Silver flowering 3	2.923
	CRR073315	Gold flowering 1	1.585
	CRR073316	Gold flowering 2	1.639
	CRR073317	Gold flowering 3	2.488
	CRR073318	Tawny withering 1	3.500
	CRR073319	Tawny withering 2	3.890
	CRR073320	Tawny withering 3	5.411