Gene detail

Detail information of GWHGAAZE022395

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009803178.1	1.4676E-148	PREDICTED: ATP-dependent Clp protease proteolytic subunit 2, mitochondrial-like [Nicotiana sylvestris]
COG	YP_032181.1	1E-86	ATP-dependent Clp protease proteolytic subunit
Swissprot	tr\|Q9FN42\|CLPP2_ARATH	1E-141	ATP-dependent Clp protease proteolytic subunit 2, mitochondrial (Precursor)
trEMBL	tr\|M1APP3\|M1APP3_SOLTU	1E-144	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	AT5G23140.1	4E-106	nuclear-encoded CLP protease P7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	71794829	71797290	+
GWHAAZE00000006	mRNA	71794829	71797290	+
GWHAAZE00000006	exon	71794829	71795138	+
GWHAAZE00000006	exon	71795214	71795246	+
GWHAAZE00000006	exon	71796872	71797290	+
GWHAAZE00000006	CDS	71794829	71795138	+
GWHAAZE00000006	CDS	71795214	71795246	+
GWHAAZE00000006	CDS	71796872	71797290	+

Transcript Sequence
>GWHTAAZE022425 ATGCGGAGCCTAATTGCACAGAGAGTGAGCAATCTATGGACCGGAATCTCCAATCAATCGGCGCCGGCGTCAGGTACTCATCGGAGATGGTACAGCCTGATTCCGATGGTGATAGAGCACTCTTCTCGAGGAGAGAGAGCCTACGATATCTTCTCTCGTCTCCTCAAAGAGAGAATCATATGCATCAACGGCCCCATTTCCGACGACACTGCACACGTGGTAGTTGCTCAGCTCCTCTATCTCGAATCCGAAAACCCTTCTAAACCCATCCACATGTACCTCAATTCCCCCGGCGGCGCCGTCACTGCTGGGCGTTTCTACATTCGAATTGTTGATGCTGGAGGTCTTGCGATATACGATACGATGCAGTACATTCGATCTCCAATCAATACAATATGTTTGGGTCAGGCCGCATCGATGGCTTCTCTCCTATTGGCTTCTGGTACAAAGGGTGAGAGGCGATCTCTCCCTAATGCTACTGTCATGATTCATCAGCCTTCGGGTGGGTACAGTGGTCAGGCTAAAGACATGACCATTCACACAAAGCAGATTGTTCGAGTTTGGGATGCACTAAACACTTTGTATTCGAAGCATACAGGACAGTCCATTGATATAGTCCAGAAAAATATGGATCGGGATTATTTTATGACACCGGAAGAGGCAAAGGAGTTCGGGATAATTGACGAGGTTATAGATGAAAGACCAATGACACTAGTTACTGATGCTGTTGGAAATGAGAGCAAAGATAAACCTTCAAGTTAA

Network for GWHGAAZE022395

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	43	233	2.10E-74

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	26.954
	SRR3591706	second leaf	17.214
	SRR3591707	mature leaf	17.354
	SRR3591708	Shoot apex	23.562
	SRR3591709	Stem	26.270
	SRR3591710	White floral bud	28.104
	SRR3591711	White flower	28.363
	SRR3591712	Green floral bud	31.072
	SRR3591713	Yellow flower	20.122
SRP173429	SRR8316895	Juvenile bud stage	25.213
	SRR8316896	Juvenile bud stage	35.141
	SRR8316897	Juvenile bud stage	21.288
	SRR8316894	Third green stage	13.763
	SRR8316900	Third green stage	46.515
	SRR8316901	Third green stage	39.873
	SRR8316898	Complete white stage	19.016
	SRR8316899	Complete white stage	58.461
	SRR8316903	Complete white stage	25.580
	SRR8316902	Silver flowering stage	13.459
	SRR8316904	Silver flowering stage	17.424
	SRR8316905	Silver flowering stage	7.649
	SRR8316906	Gold flowering stage	29.349
	SRR8316907	Gold flowering stage	32.207
	SRR8316908	Gold flowering stage	33.783
SRP132670	SRR6706286	Control	58.052
	SRR6706287	Light intensity 50%	60.882
	SRR6706288	Light intensity 20%	59.422
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.954
	CNS0095593	Slightly white alabastrum(diploid) 2	39.146
	CNS0095594	Slightly white alabastrum(diploid) 3	39.247
	CNS0095595	Whole white alabastrum(diploid) 2	33.732
	CNS0095596	Whole white alabastrum(diploid) 3	32.375
	CNS0095597	Whole white alabastrum(diploid) 4	29.549
	CNS0095598	Silvery flower (diploied) 1	27.824
	CNS0095599	Silvery flower (diploied) 2	25.260
	CNS0095600	Silvery flower (diploied) 3	40.327
	CNS0095601	Golden flower (diploid) 1	27.541
	CNS0095602	Golden flower (diploid) 2	29.823
	CNS0095603	Golden flower (diploid) 3	31.250
	CNS0095604	Slightly white alabastrum(tetraploid) 1	41.282
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.715
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.112
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.885
	CNS0095608	Whole white alabastrum(tetraploid) 2	32.157
	CNS0095609	Whole white alabastrum(tetraploid) 3	41.061
	CNS0095610	Silvery flower (tetraploid) 1	31.602
	CNS0095611	Silvery flower (tetraploid) 2	39.777
	CNS0095612	Silvery flower (tetraploid) 3	37.399
	CNS0095613	Golden flower (tetraploid) 1	25.067
	CNS0095614	Golden flower (tetraploid) 2	26.009
	CNS0095615	Golden flower (tetraploid) 3	29.129
CRA001975	CRR073297	Stem 1	41.948
	CRR073298	Stem 2	43.451
	CRR073299	Stem 3	49.681
	CRR073300	Leaf 1	44.775
	CRR073301	Leaf 2	47.977
	CRR073302	Leaf 3	60.690
	CRR073303	Juvenile bud 1	54.135
	CRR073304	Juvenile bud 2	56.676
	CRR073305	Juvenile bud 3	46.669
	CRR073306	Third green 1	23.286
	CRR073307	Third green 2	25.786
	CRR073308	Third green 3	21.869
	CRR073309	Second white 1	26.416
	CRR073310	Second white 2	23.863
	CRR073311	Second white 3	16.533
	CRR073312	Silver flowering 1	15.010
	CRR073313	Silver flowering 2	15.211
	CRR073314	Silver flowering 3	13.614
	CRR073315	Gold flowering 1	26.566
	CRR073316	Gold flowering 2	33.367
	CRR073317	Gold flowering 3	25.604
	CRR073318	Tawny withering 1	32.135
	CRR073319	Tawny withering 2	41.345
	CRR073320	Tawny withering 3	29.051