Gene detail

Detail information of GWHGAAZE022519

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010104706.1	4.68231E-58	putative calcium-binding protein CML25 [Morus notabilis]
COG	YP_001866396.1	4E-16	signal transduction protein
Swissprot	tr\|Q9FYK2\|CML25_ARATH	6E-46	Probable calcium-binding protein CML25
trEMBL	tr\|W9SF34\|W9SF34_9ROSA	2E-58	Putative calcium-binding protein CML25 {ECO:0000313\|EMBL:EXC48677.1}
TAIR10	AT1G24620.1	2E-37	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	73850226	73850609	+
GWHAAZE00000006	mRNA	73850226	73850609	+
GWHAAZE00000006	exon	73850226	73850609	+
GWHAAZE00000006	CDS	73850226	73850609	+

Transcript Sequence
>GWHTAAZE022549 ATGGGCAGCCTCGGCCAGCAGACCTCGGACGAGGAACTTCAGAACATGATCAAAGAGGTAGATTCGGATGGAGACGGTTTTATTGATTTGAAAGAATTTATCGAACTTAACACCAAGGATATTGGACACGATGAAGTGTTGGAGAGTTTGAAGACTGCTTTTGCTGTATTTGATATTGACAAGAACGGTTCGATAACCGCTGATGAGCTGCAAAACGTGCTGGGGAGTTTGGGGGAGGAGTGCTCCATCGCCGAATGTAGGAAGATGATTAGTGGGGTGGATAGGAATGGAGACGGCGTCATTAGTTTTGATGAGTTTAAGGTTATGATGATGGCCGGTTCGCGTTTTGATGGGTTAGGGTCGCAGAGAGTTATGGTAGATTGA

Network for GWHGAAZE022519

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13833.7	EF-hand_8	4	36	4.00E-08
PF13499.7	EF-hand_7	48	110	2.20E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	65.752
	SRR3591706	second leaf	2.304
	SRR3591707	mature leaf	3.313
	SRR3591708	Shoot apex	6.941
	SRR3591709	Stem	77.594
	SRR3591710	White floral bud	95.338
	SRR3591711	White flower	28.311
	SRR3591712	Green floral bud	71.353
	SRR3591713	Yellow flower	9.847
SRP173429	SRR8316895	Juvenile bud stage	20.431
	SRR8316896	Juvenile bud stage	31.944
	SRR8316897	Juvenile bud stage	22.191
	SRR8316894	Third green stage	6.901
	SRR8316900	Third green stage	21.075
	SRR8316901	Third green stage	36.121
	SRR8316898	Complete white stage	1.317
	SRR8316899	Complete white stage	87.347
	SRR8316903	Complete white stage	2.768
	SRR8316902	Silver flowering stage	3.646
	SRR8316904	Silver flowering stage	0.720
	SRR8316905	Silver flowering stage	2.253
	SRR8316906	Gold flowering stage	5.911
	SRR8316907	Gold flowering stage	2.781
	SRR8316908	Gold flowering stage	2.130
SRP132670	SRR6706286	Control	17.879
	SRR6706287	Light intensity 50%	18.948
	SRR6706288	Light intensity 20%	17.833
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.997
	CNS0095593	Slightly white alabastrum(diploid) 2	30.505
	CNS0095594	Slightly white alabastrum(diploid) 3	24.948
	CNS0095595	Whole white alabastrum(diploid) 2	31.278
	CNS0095596	Whole white alabastrum(diploid) 3	14.461
	CNS0095597	Whole white alabastrum(diploid) 4	46.520
	CNS0095598	Silvery flower (diploied) 1	22.841
	CNS0095599	Silvery flower (diploied) 2	42.853
	CNS0095600	Silvery flower (diploied) 3	21.721
	CNS0095601	Golden flower (diploid) 1	16.906
	CNS0095602	Golden flower (diploid) 2	18.504
	CNS0095603	Golden flower (diploid) 3	18.656
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.496
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.325
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.394
	CNS0095607	Whole white alabastrum(tetraploid) 1	44.950
	CNS0095608	Whole white alabastrum(tetraploid) 2	62.567
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.724
	CNS0095610	Silvery flower (tetraploid) 1	0.855
	CNS0095611	Silvery flower (tetraploid) 2	2.490
	CNS0095612	Silvery flower (tetraploid) 3	13.233
	CNS0095613	Golden flower (tetraploid) 1	2.265
	CNS0095614	Golden flower (tetraploid) 2	0.989
	CNS0095615	Golden flower (tetraploid) 3	1.361
CRA001975	CRR073297	Stem 1	22.423
	CRR073298	Stem 2	29.014
	CRR073299	Stem 3	23.644
	CRR073300	Leaf 1	118.520
	CRR073301	Leaf 2	119.817
	CRR073302	Leaf 3	86.954
	CRR073303	Juvenile bud 1	120.698
	CRR073304	Juvenile bud 2	214.595
	CRR073305	Juvenile bud 3	140.446
	CRR073306	Third green 1	68.929
	CRR073307	Third green 2	112.779
	CRR073308	Third green 3	72.071
	CRR073309	Second white 1	22.864
	CRR073310	Second white 2	23.754
	CRR073311	Second white 3	29.989
	CRR073312	Silver flowering 1	82.815
	CRR073313	Silver flowering 2	66.580
	CRR073314	Silver flowering 3	61.889
	CRR073315	Gold flowering 1	46.373
	CRR073316	Gold flowering 2	48.436
	CRR073317	Gold flowering 3	41.919
	CRR073318	Tawny withering 1	41.725
	CRR073319	Tawny withering 2	88.583
	CRR073320	Tawny withering 3	47.823