Gene detail

Detail information of GWHGAAZE022563

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010657445.1	4.33404E-47	PREDICTED: homeobox-leucine zipper protein HOX3 [Vitis vinifera]
Swissprot	tr\|Q8S9N6\|ATB17_ARATH	9E-38	Homeobox-leucine zipper protein ATHB-17
trEMBL	tr\|D7T8T6\|D7T8T6_VITVI	2E-47	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI26907.3}
TAIR10	AT2G01430.1	2E-21	homeobox-leucine zipper protein 17

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	74581089	74582212	+
GWHAAZE00000006	mRNA	74581089	74582212	+
GWHAAZE00000006	exon	74581089	74581188	+
GWHAAZE00000006	exon	74581536	74581816	+
GWHAAZE00000006	exon	74581991	74582070	+
GWHAAZE00000006	exon	74582167	74582212	+
GWHAAZE00000006	CDS	74581089	74581188	+
GWHAAZE00000006	CDS	74581536	74581816	+
GWHAAZE00000006	CDS	74581991	74582070	+
GWHAAZE00000006	CDS	74582167	74582212	+

Transcript Sequence
>GWHTAAZE022593 ATGGCGGATAATAAACCCACAAGCTCTACTTGTTTGGAACTAACAATATCCGTACCTGGCTTTGCTTCTTCATCTCCATCCCTTCCTTATTCCTTCTCAGGAGAAGGAGGTGGTGGTGGTGGTATGAGAAATTTGGACATAAATAAAGTGCCGTCGGGAGAGGGAGAAGAAGAAGAAGATCATGAATGGATGATGATGATGACGACGACGACAACAGGAAGCATGGAGGAAGAAGTAGAAGAGGAGGAGGGGGAGTGGCCTGCTGCTGCTGCCGCCGCCGCCACCAATGGAGGAGGTCCTCCGCGTAAGAAACTACGCCTCACCAAGGAACAGTCTCGTCTCCTTGAAGAAAGCTTTCGCCAAAATCACACCTTGAACCCTAAACAAAAAGAGGGTTTAGCGATGCAATTGAAGCTCAAGCCCCGACAAGTTGAGGTCTGGTTTCAAAATCGTAGAGCAAGTGCCTACTTTATCAGAAAGCTATTATCTCACCACAAAGTAAAGTAA

Network for GWHGAAZE022563

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	102	153	7.10E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-other

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.821
	SRR3591706	second leaf	0.633
	SRR3591707	mature leaf	0.273
	SRR3591708	Shoot apex	0.854
	SRR3591709	Stem	3.077
	SRR3591710	White floral bud	0.563
	SRR3591711	White flower	28.350
	SRR3591712	Green floral bud	5.192
	SRR3591713	Yellow flower	35.440
SRP173429	SRR8316895	Juvenile bud stage	1.635
	SRR8316896	Juvenile bud stage	3.676
	SRR8316897	Juvenile bud stage	1.187
	SRR8316894	Third green stage	1.251
	SRR8316900	Third green stage	2.024
	SRR8316901	Third green stage	1.299
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.016
	SRR8316903	Complete white stage	0.340
	SRR8316902	Silver flowering stage	0.866
	SRR8316904	Silver flowering stage	0.805
	SRR8316905	Silver flowering stage	0.897
	SRR8316906	Gold flowering stage	10.207
	SRR8316907	Gold flowering stage	5.876
	SRR8316908	Gold flowering stage	9.945
SRP132670	SRR6706286	Control	3.998
	SRR6706287	Light intensity 50%	2.679
	SRR6706288	Light intensity 20%	2.806
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.448
	CNS0095593	Slightly white alabastrum(diploid) 2	0.672
	CNS0095594	Slightly white alabastrum(diploid) 3	1.222
	CNS0095595	Whole white alabastrum(diploid) 2	0.557
	CNS0095596	Whole white alabastrum(diploid) 3	0.711
	CNS0095597	Whole white alabastrum(diploid) 4	1.362
	CNS0095598	Silvery flower (diploied) 1	0.293
	CNS0095599	Silvery flower (diploied) 2	0.717
	CNS0095600	Silvery flower (diploied) 3	0.363
	CNS0095601	Golden flower (diploid) 1	1.165
	CNS0095602	Golden flower (diploid) 2	2.070
	CNS0095603	Golden flower (diploid) 3	2.319
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.715
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.035
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.214
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.817
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.426
	CNS0095610	Silvery flower (tetraploid) 1	3.001
	CNS0095611	Silvery flower (tetraploid) 2	1.540
	CNS0095612	Silvery flower (tetraploid) 3	5.475
	CNS0095613	Golden flower (tetraploid) 1	14.147
	CNS0095614	Golden flower (tetraploid) 2	4.997
	CNS0095615	Golden flower (tetraploid) 3	13.232
CRA001975	CRR073297	Stem 1	1.918
	CRR073298	Stem 2	3.639
	CRR073299	Stem 3	3.226
	CRR073300	Leaf 1	1.444
	CRR073301	Leaf 2	1.541
	CRR073302	Leaf 3	1.212
	CRR073303	Juvenile bud 1	0.234
	CRR073304	Juvenile bud 2	0.074
	CRR073305	Juvenile bud 3	0.530
	CRR073306	Third green 1	10.127
	CRR073307	Third green 2	8.018
	CRR073308	Third green 3	7.092
	CRR073309	Second white 1	51.277
	CRR073310	Second white 2	34.871
	CRR073311	Second white 3	49.114
	CRR073312	Silver flowering 1	63.122
	CRR073313	Silver flowering 2	52.578
	CRR073314	Silver flowering 3	59.931
	CRR073315	Gold flowering 1	2.496
	CRR073316	Gold flowering 2	3.883
	CRR073317	Gold flowering 3	2.584
	CRR073318	Tawny withering 1	2.729
	CRR073319	Tawny withering 2	1.116
	CRR073320	Tawny withering 3	2.667