Gene detail

Detail information of GWHGAAZE022701

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008339734.1	7.3697E-99	PREDICTED: ASC1-like protein [Malus domestica]
Swissprot	tr\|Q8W4Y5\|ASCL_SOLLC	8E-94	ASC1-like protein
trEMBL	tr\|A0A067K8T5\|A0A067K8T5_JATCU	2E-98	Uncharacterized protein {ECO:0000313\|EMBL:KDP31433.1}
TAIR10	AT1G13580.1	3E-74	LAG1 longevity assurance homolog 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	77137424	77140148	-
GWHAAZE00000006	mRNA	77137424	77140148	-
GWHAAZE00000006	exon	77140011	77140148	-
GWHAAZE00000006	exon	77138141	77138292	-
GWHAAZE00000006	exon	77137805	77137960	-
GWHAAZE00000006	exon	77137424	77137613	-
GWHAAZE00000006	CDS	77140011	77140148	-
GWHAAZE00000006	CDS	77138141	77138292	-
GWHAAZE00000006	CDS	77137805	77137960	-
GWHAAZE00000006	CDS	77137424	77137613	-

Transcript Sequence
>GWHTAAZE022731 ATGGGTCTACTAGAAACCCTAAGTTCACTTGATTGGGAAAAAGAATCATATCCACAGTATGAAGATTACGCTGTTCTTCCCTTCTTCGTGCTGCTGTTCCCTTCAATTCGTTTCTTTCTCGATAGATTCGTATTCGAGAAAGTGGGAAGACGGTTGATATTTGGGAAGGGGCAGCAAAAACTAGAGGTTGAGACTGATGATAGGAGAAAGAAGATCCAAATTCAAGGAATCAGCTTGGAAATGTGTTTATTATTTTTCAGCAGAGGTTCTAGCGATATCTGTAACTTATGGTTGAAATTGAAAGGGCTTTATATGTTTGCTGGCGGGTTCTACACCTACTCCATATTTGCTCTGATTTTTTGGGAAACAAGGCGATCCGACTTTGGAGTTTCAATGGGTCATCATGTCGCCACTGCCATTTTAATTGTATTGTCTTACATATATGGGTTTGCCCGTGCTGGTTCAATGGTTTTAGCTCTTCACGATGCTAGTGATGTATTTCTGGAAATAGGGAAGATGTCCAAATACAGTGGAGCTGAAGCTCTTGCAAGCTTTTCATTTGTTCTTTTTGTTTTGTCCTGGATACTACTTCGCCTCATTTATTATCCATTCTGGATCCTCTGGAGTACAAGGTGA

Network for GWHGAAZE022701

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03798.17	TRAM_LAG1_CLN8	100	210	2.10E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K23727	CERS5_6, LASS5_6	Metabolic pathways	map01100
		Sphingolipid metabolism	map00600
		Sphingolipid signaling pathway	map04071

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	51.161
	SRR3591706	second leaf	23.341
	SRR3591707	mature leaf	32.492
	SRR3591708	Shoot apex	33.529
	SRR3591709	Stem	69.328
	SRR3591710	White floral bud	41.255
	SRR3591711	White flower	43.884
	SRR3591712	Green floral bud	46.985
	SRR3591713	Yellow flower	33.909
SRP173429	SRR8316895	Juvenile bud stage	17.570
	SRR8316896	Juvenile bud stage	23.350
	SRR8316897	Juvenile bud stage	10.723
	SRR8316894	Third green stage	14.085
	SRR8316900	Third green stage	34.313
	SRR8316901	Third green stage	32.684
	SRR8316898	Complete white stage	16.271
	SRR8316899	Complete white stage	75.185
	SRR8316903	Complete white stage	29.050
	SRR8316902	Silver flowering stage	11.538
	SRR8316904	Silver flowering stage	21.282
	SRR8316905	Silver flowering stage	10.014
	SRR8316906	Gold flowering stage	32.526
	SRR8316907	Gold flowering stage	28.059
	SRR8316908	Gold flowering stage	30.810
SRP132670	SRR6706286	Control	21.915
	SRR6706287	Light intensity 50%	20.633
	SRR6706288	Light intensity 20%	24.784
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.800
	CNS0095593	Slightly white alabastrum(diploid) 2	34.602
	CNS0095594	Slightly white alabastrum(diploid) 3	27.580
	CNS0095595	Whole white alabastrum(diploid) 2	38.512
	CNS0095596	Whole white alabastrum(diploid) 3	32.200
	CNS0095597	Whole white alabastrum(diploid) 4	38.316
	CNS0095598	Silvery flower (diploied) 1	38.850
	CNS0095599	Silvery flower (diploied) 2	32.715
	CNS0095600	Silvery flower (diploied) 3	56.915
	CNS0095601	Golden flower (diploid) 1	32.861
	CNS0095602	Golden flower (diploid) 2	49.626
	CNS0095603	Golden flower (diploid) 3	46.737
	CNS0095604	Slightly white alabastrum(tetraploid) 1	43.339
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.948
	CNS0095606	Slightly white alabastrum(tetraploid) 3	73.837
	CNS0095607	Whole white alabastrum(tetraploid) 1	44.335
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.526
	CNS0095609	Whole white alabastrum(tetraploid) 3	40.836
	CNS0095610	Silvery flower (tetraploid) 1	60.070
	CNS0095611	Silvery flower (tetraploid) 2	61.254
	CNS0095612	Silvery flower (tetraploid) 3	37.649
	CNS0095613	Golden flower (tetraploid) 1	25.985
	CNS0095614	Golden flower (tetraploid) 2	48.605
	CNS0095615	Golden flower (tetraploid) 3	38.268
CRA001975	CRR073297	Stem 1	18.220
	CRR073298	Stem 2	15.098
	CRR073299	Stem 3	12.002
	CRR073300	Leaf 1	22.370
	CRR073301	Leaf 2	19.652
	CRR073302	Leaf 3	15.185
	CRR073303	Juvenile bud 1	20.420
	CRR073304	Juvenile bud 2	15.348
	CRR073305	Juvenile bud 3	24.040
	CRR073306	Third green 1	6.875
	CRR073307	Third green 2	7.717
	CRR073308	Third green 3	7.094
	CRR073309	Second white 1	7.907
	CRR073310	Second white 2	9.115
	CRR073311	Second white 3	7.301
	CRR073312	Silver flowering 1	8.674
	CRR073313	Silver flowering 2	14.289
	CRR073314	Silver flowering 3	6.428
	CRR073315	Gold flowering 1	10.737
	CRR073316	Gold flowering 2	17.587
	CRR073317	Gold flowering 3	15.026
	CRR073318	Tawny withering 1	19.044
	CRR073319	Tawny withering 2	20.846
	CRR073320	Tawny withering 3	23.918