Gene detail

Detail information of GWHGAAZE022704

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP00505.1	4.87333E-88	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FMC2\|BZP43_ARATH	3E-37	Basic leucine zipper 43
trEMBL	tr\|A0A068TW22\|A0A068TW22_COFCA	2E-88	Coffea canephora DH200=94 genomic scaffold, scaffold_5 {ECO:0000313\|EMBL:CDP00505.1}
TAIR10	AT3G30530.1	1E-36	basic leucine-zipper 42

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	77192049	77192627	-
GWHAAZE00000006	mRNA	77192049	77192627	-
GWHAAZE00000006	exon	77192049	77192627	-
GWHAAZE00000006	CDS	77192049	77192627	-

Transcript Sequence
>GWHTAAZE022734 ATGCTTTTTCCATCTGATCTCCCGAGTATCCACTCCCTAACTCCCCAAGACCCCTTCTCTTTTCCCACTAACCTTGGCTTCACACAAAACAATATCTCATCACTCCACTTCTTAAACAACTTACCCAATTCTCAAAACTATCTTCCTCCTCTCCATGAGTTCACCCCACAGTCCTCGTGCCTTAGCAATAACTCGACCTCTGATGAGGACCAACTCAGCATCATCGACGAGAGGAAGCAGAGGAGAATGATATCTAACAGGGAATCAGCTCGAAGGTCCCGTATGAGGAAACAGAGGCACCTGGATGAGCTATGGTCACAGGTGGTTCGTCTAAGAACAGAGAATCACAATCTCATAGACAAATTGAATCACATGTCAGAGTGCCATGACAAGGTTCTCGAGGAGAATACGCGGCTCAAGGAAGAATCATCAGACCTTCGTCAAATGCTAACTGACCTACAACTTGCTAGTACTTTTACTAGTTTAAGAGATCTAGACGAGGTTCCTTGCACCACAGCTCATCTCAGGGCTGAATCTTCAAACCAATCCATCACGGCCTCCACAAATCTGCTCCATTGA

Network for GWHGAAZE022704

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	78	136	1.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.145
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.212
	SRR3591708	Shoot apex	2.067
	SRR3591709	Stem	5.912
	SRR3591710	White floral bud	15.771
	SRR3591711	White flower	17.529
	SRR3591712	Green floral bud	11.584
	SRR3591713	Yellow flower	2.986
SRP173429	SRR8316895	Juvenile bud stage	4.025
	SRR8316896	Juvenile bud stage	2.002
	SRR8316897	Juvenile bud stage	1.572
	SRR8316894	Third green stage	2.220
	SRR8316900	Third green stage	7.507
	SRR8316901	Third green stage	2.741
	SRR8316898	Complete white stage	0.313
	SRR8316899	Complete white stage	3.555
	SRR8316903	Complete white stage	2.866
	SRR8316902	Silver flowering stage	0.304
	SRR8316904	Silver flowering stage	0.343
	SRR8316905	Silver flowering stage	0.143
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.344
SRP132670	SRR6706286	Control	10.783
	SRR6706287	Light intensity 50%	7.619
	SRR6706288	Light intensity 20%	6.406
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.592
	CNS0095593	Slightly white alabastrum(diploid) 2	4.613
	CNS0095594	Slightly white alabastrum(diploid) 3	1.890
	CNS0095595	Whole white alabastrum(diploid) 2	4.484
	CNS0095596	Whole white alabastrum(diploid) 3	1.336
	CNS0095597	Whole white alabastrum(diploid) 4	0.757
	CNS0095598	Silvery flower (diploied) 1	7.026
	CNS0095599	Silvery flower (diploied) 2	2.923
	CNS0095600	Silvery flower (diploied) 3	1.652
	CNS0095601	Golden flower (diploid) 1	1.795
	CNS0095602	Golden flower (diploid) 2	1.443
	CNS0095603	Golden flower (diploid) 3	0.881
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.774
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.455
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.390
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.965
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.509
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.026
	CNS0095610	Silvery flower (tetraploid) 1	2.003
	CNS0095611	Silvery flower (tetraploid) 2	5.822
	CNS0095612	Silvery flower (tetraploid) 3	1.029
	CNS0095613	Golden flower (tetraploid) 1	0.260
	CNS0095614	Golden flower (tetraploid) 2	2.607
	CNS0095615	Golden flower (tetraploid) 3	0.175
CRA001975	CRR073297	Stem 1	11.866
	CRR073298	Stem 2	12.506
	CRR073299	Stem 3	32.364
	CRR073300	Leaf 1	5.592
	CRR073301	Leaf 2	12.702
	CRR073302	Leaf 3	10.981
	CRR073303	Juvenile bud 1	18.172
	CRR073304	Juvenile bud 2	3.306
	CRR073305	Juvenile bud 3	28.023
	CRR073306	Third green 1	46.375
	CRR073307	Third green 2	50.707
	CRR073308	Third green 3	54.617
	CRR073309	Second white 1	4.212
	CRR073310	Second white 2	0.861
	CRR073311	Second white 3	0.528
	CRR073312	Silver flowering 1	0.530
	CRR073313	Silver flowering 2	0.461
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.408
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	2.086