Gene detail

Detail information of GWHGAAZE022803

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010257380.1	2.78194E-55	PREDICTED: zinc-finger homeodomain protein 9 [Nelumbo nucifera]
Swissprot	tr\|Q9SEZ1\|ZHD11_ARATH	4E-40	Zinc-finger homeodomain protein 11
trEMBL	tr\|F6HPR3\|F6HPR3_VITVI	7E-51	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB56544.1}
TAIR10	AT1G69600.1	9E-29	zinc finger homeodomain 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	78773548	78774060	+
GWHAAZE00000006	mRNA	78773548	78774060	+
GWHAAZE00000006	exon	78773548	78773645	+
GWHAAZE00000006	exon	78773685	78774060	+
GWHAAZE00000006	CDS	78773548	78773645	+
GWHAAZE00000006	CDS	78773685	78774060	+

Transcript Sequence
>GWHTAAZE022833 ATGCAGTCCTCAACCGCCACCCCTACCGACCCCACCTCACTAACATGCGCGGCTTGTGGCTGCCACCGCAATTTCCACCGCCGCGAATCCGACAACCCGGGCTCACCGTCGCCGTCACCCTCACCACCTCCCCTGCCATATGCCCCTCACATGTTGCTGGCCCTCAGAACAGCCGCGGCGCCGGAGGATCATCACCGCCAGCAGCAGCAAGCTGTGGCGACGCCGGCCACCCCGACGGCGCTTAAGGCGGAGAATTCAAGCGGTAGAAAACGGTTCCGAACAAAATTCAGCCAAGAGCAGAAAGATAAAATGCTATCATTTGCAGAGAAACTGGGGTGGAAAATGCAGAAGAGCGATGAAGATATAGTGGAGAAGTTCTGCAATGAAATTGGGATAGGTAAAGGTGTACTTAAAGTGTGGCTCCACAATAATAAGAGCACCCTTGGCAAAAGATCAGACACCATTAACAACAGT

Network for GWHGAAZE022803

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04770.13	ZF-HD_dimer	7	30	1.10E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	zf-HD

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.232
	SRR3591706	second leaf	0.164
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	4.724
	SRR3591709	Stem	3.750
	SRR3591710	White floral bud	2.166
	SRR3591711	White flower	1.805
	SRR3591712	Green floral bud	1.221
	SRR3591713	Yellow flower	1.256
SRP173429	SRR8316895	Juvenile bud stage	1.590
	SRR8316896	Juvenile bud stage	0.962
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.170
	SRR8316900	Third green stage	0.162
	SRR8316901	Third green stage	0.205
	SRR8316898	Complete white stage	0.139
	SRR8316899	Complete white stage	0.376
	SRR8316903	Complete white stage	0.349
	SRR8316902	Silver flowering stage	0.940
	SRR8316904	Silver flowering stage	0.996
	SRR8316905	Silver flowering stage	0.117
	SRR8316906	Gold flowering stage	0.115
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.106
SRP132670	SRR6706286	Control	0.548
	SRR6706287	Light intensity 50%	0.360
	SRR6706288	Light intensity 20%	0.615
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.642
	CNS0095593	Slightly white alabastrum(diploid) 2	0.513
	CNS0095594	Slightly white alabastrum(diploid) 3	0.301
	CNS0095595	Whole white alabastrum(diploid) 2	0.309
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.398
	CNS0095598	Silvery flower (diploied) 1	4.541
	CNS0095599	Silvery flower (diploied) 2	2.795
	CNS0095600	Silvery flower (diploied) 3	1.149
	CNS0095601	Golden flower (diploid) 1	2.508
	CNS0095602	Golden flower (diploid) 2	1.041
	CNS0095603	Golden flower (diploid) 3	1.189
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.952
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.272
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.994
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.278
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.149
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.164
	CNS0095610	Silvery flower (tetraploid) 1	3.996
	CNS0095611	Silvery flower (tetraploid) 2	2.321
	CNS0095612	Silvery flower (tetraploid) 3	3.072
	CNS0095613	Golden flower (tetraploid) 1	1.175
	CNS0095614	Golden flower (tetraploid) 2	6.982
	CNS0095615	Golden flower (tetraploid) 3	3.840
CRA001975	CRR073297	Stem 1	2.388
	CRR073298	Stem 2	1.710
	CRR073299	Stem 3	2.213
	CRR073300	Leaf 1	0.081
	CRR073301	Leaf 2	0.766
	CRR073302	Leaf 3	0.489
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.109
	CRR073306	Third green 1	0.071
	CRR073307	Third green 2	0.020
	CRR073308	Third green 3	0.700
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.100
	CRR073311	Second white 3	0.074
	CRR073312	Silver flowering 1	0.006
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.794
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	2.479
	CRR073319	Tawny withering 2	1.444
	CRR073320	Tawny withering 3	4.396