Gene detail

Detail information of GWHGAAZE022845

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP21876.1	2.0226E-42	unnamed protein product [Coffea canephora]
COG	YP_007124432.1	9E-20	thioredoxin
Swissprot	tr\|Q38879\|TRXH2_ARATH	1E-34	Thioredoxin H2
trEMBL	tr\|A0A068VME5\|A0A068VME5_COFCA	8E-43	Thioredoxin {ECO:0000256\|PIRNR:PIRNR000077}
TAIR10	AT5G39950.1	1E-27	thioredoxin 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	79596635	79597057	+
GWHAAZE00000006	mRNA	79596635	79597057	+
GWHAAZE00000006	exon	79596635	79596757	+
GWHAAZE00000006	exon	79596926	79597057	+
GWHAAZE00000006	CDS	79596635	79596757	+
GWHAAZE00000006	CDS	79596926	79597057	+

Transcript Sequence
>GWHTAAZE022875 ATGGTTATTGATTTCACGGCTTCATGGTGCGGACCTTGTCGATACATGGAACCCACCTTTAACGAGTTTGCTGCTCAATATACTGATGTCGTGTTCGTAAGGATTGACGTGGACGAGTTGATGGATGTGGCTAAAGAATATGGGGTGGAGGCAATGCCAACATTCTTACTGATGAAGAAAGGAAAAGAAGTTGATAAGGTTATTGGGGCCAAGAAGGATGAACTCCAAAAGAAGATTGAGAAGCACATGCTTTGA

Network for GWHGAAZE022845

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	1	81	2.40E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.346
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.296
	SRR3591709	Stem	7.726
	SRR3591710	White floral bud	0.260
	SRR3591711	White flower	0.418
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.291
	SRR8316896	Juvenile bud stage	1.388
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.209
	SRR8316900	Third green stage	0.639
	SRR8316901	Third green stage	0.745
	SRR8316898	Complete white stage	0.517
	SRR8316899	Complete white stage	0.461
	SRR8316903	Complete white stage	0.521
	SRR8316902	Silver flowering stage	0.561
	SRR8316904	Silver flowering stage	0.270
	SRR8316905	Silver flowering stage	0.123
	SRR8316906	Gold flowering stage	0.399
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.372
	SRR6706287	Light intensity 50%	0.277
	SRR6706288	Light intensity 20%	0.703
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.228
	CNS0095593	Slightly white alabastrum(diploid) 2	0.144
	CNS0095594	Slightly white alabastrum(diploid) 3	1.223
	CNS0095595	Whole white alabastrum(diploid) 2	0.208
	CNS0095596	Whole white alabastrum(diploid) 3	0.578
	CNS0095597	Whole white alabastrum(diploid) 4	0.082
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.545
	CNS0095600	Silvery flower (diploied) 3	0.466
	CNS0095601	Golden flower (diploid) 1	0.160
	CNS0095602	Golden flower (diploid) 2	0.387
	CNS0095603	Golden flower (diploid) 3	0.608
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.289
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.153
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.128
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.201
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.076
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.382
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.384
	CNS0095612	Silvery flower (tetraploid) 3	0.209
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.155
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.379
	CRR073298	Stem 2	0.023
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.220
	CRR073301	Leaf 2	0.314
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000