Gene detail

Detail information of GWHGAAZE022982

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282185.1	4.70284E-85	PREDICTED: cytochrome P450 86B1 [Vitis vinifera]
COG	YP_004448498.1	5E-20	monooxygenase
Swissprot	tr\|Q9FMY1\|C86B1_ARATH	6E-65	Cytochrome P450 86B1
trEMBL	tr\|A5C696\|A5C696_VITVI	2E-85	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN77648.1}
TAIR10	AT1G24540.1	1E-62	cytochrome P450, family 86, subfamily C, polypeptide 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	81565990	81566478	-
GWHAAZE00000006	mRNA	81565990	81566478	-
GWHAAZE00000006	exon	81565990	81566478	-
GWHAAZE00000006	CDS	81565990	81566478	-

Transcript Sequence
>GWHTAAZE023012 ATGAGTGACATAGTTTTTACAGAAGATGAGTTAAAAGAGAAGGTCTATTTACATGCTGCAATATCCGAATCCTTGAGGCTTTACCCACCGGTTCCTATTGATTTTAAGGAGGTTTTAGAGGACGATTTGTTCCCCGATGGGACAGTGATTAGGCGAGGGGCTCGAGTTCTGTACTCCATTTACTCGATGGCTCGATTGGAGTCGATTTGGGGAAAGGATTGCAATGAGTTCAAGCCAGAGAGGTGGATAAAAGATGGTGAATTTGTGAGTGAGAATCAGTTCAAGTACGTTGTGTTTAATGGAGGGCCAAGATTGTGTGTGGGGAAGAAGTTTGCTTATATGCAGATGAAAATGGTGGCTGCTTCGATTCTGTTGAGTTGTTCAGTTAAGGTTGTTGAAGGGCATGAAGTCTGTCCAAAGGTGACTACTACTCTTTATATGAAGAATGGGCTTTTGGTGAATTTGGAGCCTAGGGTCAACCTCTTCTGA

Network for GWHGAAZE022982

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0121

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	6	144	6.80E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15402	CYP86B1	Cutin, suberine and wax biosynthesis	map00073

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding
GO:0004497	molecular_function	monooxygenase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.433
	SRR3591706	second leaf	0.594
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.767
	SRR3591709	Stem	0.830
	SRR3591710	White floral bud	0.511
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	3.130
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	7.521
	SRR8316896	Juvenile bud stage	9.357
	SRR8316897	Juvenile bud stage	3.376
	SRR8316894	Third green stage	4.388
	SRR8316900	Third green stage	4.271
	SRR8316901	Third green stage	6.552
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.206
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	8.452
	SRR6706287	Light intensity 50%	6.084
	SRR6706288	Light intensity 20%	6.039
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.295
	CNS0095593	Slightly white alabastrum(diploid) 2	1.736
	CNS0095594	Slightly white alabastrum(diploid) 3	10.391
	CNS0095595	Whole white alabastrum(diploid) 2	1.604
	CNS0095596	Whole white alabastrum(diploid) 3	1.698
	CNS0095597	Whole white alabastrum(diploid) 4	2.242
	CNS0095598	Silvery flower (diploied) 1	0.382
	CNS0095599	Silvery flower (diploied) 2	1.202
	CNS0095600	Silvery flower (diploied) 3	0.281
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.076
	CNS0095603	Golden flower (diploid) 3	0.076
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.867
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.297
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.911
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.009
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.044
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.357
	CNS0095610	Silvery flower (tetraploid) 1	0.282
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.125
	CNS0095613	Golden flower (tetraploid) 1	0.101
	CNS0095614	Golden flower (tetraploid) 2	0.395
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	7.491
	CRR073298	Stem 2	9.029
	CRR073299	Stem 3	22.576
	CRR073300	Leaf 1	0.704
	CRR073301	Leaf 2	0.991
	CRR073302	Leaf 3	4.120
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.163
	CRR073308	Third green 3	0.106
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.384
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.833
	CRR073319	Tawny withering 2	0.666
	CRR073320	Tawny withering 3	0.293