Gene detail

Detail information of GWHGAAZE023326

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004232053.1	3.88133E-67	PREDICTED: uncharacterized protein LOC101250850 [Solanum lycopersicum]
trEMBL	tr\|F6HJU4\|F6HJU4_VITVI	1E-67	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB54197.1} (Fragment)
TAIR10	AT5G66860.1	1E-43	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	5443664	5444604	+
GWHAAZE00000007	mRNA	5443664	5444604	+
GWHAAZE00000007	exon	5443664	5444026	+
GWHAAZE00000007	exon	5444419	5444604	+
GWHAAZE00000007	CDS	5443664	5444026	+
GWHAAZE00000007	CDS	5444419	5444604	+

Transcript Sequence
>GWHTAAZE023356 ATGATGTCGAAGCTGTGGACCACCGCCGGCGGCAGCCTCAGGCAAGCGGCGGAGAGGTGTAGAACCTACCACACTATTCAAGCGATTCCGAGAGAGATCACCGGAAGCAGAGTCTCCGCAAAGGACAGAAACCAAGGCCGAATACCGGCCGTCGTTTTGACGCAAAACTTCGTCGAATCAAAAACTAGCGATGGTCGTACCATCACTAGCTGCTCAATCTCGAAGAAATTTCTAATCACTACTGAGAAAAAGCAGATTCAGTCCATTCTCGACTCGGTTCAACCCCGGTTCTTCTGCTCCACTACTTTTCCCCTTCAGATCCGAGCCGGCTCCGGTTCCTCTGTTCTCCTTCAATCCGCAAAAGTTCATAGAGATGAAAATACGGGGAAGATTCTCAATTTGGTATTTGCTTGGGTCGATGAAGGGAAGGATTTGAGAGTTGATGTGCCTATCGTGTTGAAAGGCGAAGATATTTGTCCTGGTCTGAAGAAAGGTTTGTGTTGTAATTTCTCTTACATGCCTTATTTGTTCTATGTGCTTGCATTTTGA

Network for GWHGAAZE023326

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02897	RP-L25, rplY	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0008097	molecular_function	5S rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.811
	SRR3591706	second leaf	5.090
	SRR3591707	mature leaf	7.620
	SRR3591708	Shoot apex	18.626
	SRR3591709	Stem	7.032
	SRR3591710	White floral bud	9.096
	SRR3591711	White flower	15.371
	SRR3591712	Green floral bud	14.884
	SRR3591713	Yellow flower	6.585
SRP173429	SRR8316895	Juvenile bud stage	7.800
	SRR8316896	Juvenile bud stage	10.595
	SRR8316897	Juvenile bud stage	3.958
	SRR8316894	Third green stage	4.777
	SRR8316900	Third green stage	11.195
	SRR8316901	Third green stage	12.002
	SRR8316898	Complete white stage	2.932
	SRR8316899	Complete white stage	15.638
	SRR8316903	Complete white stage	4.126
	SRR8316902	Silver flowering stage	3.741
	SRR8316904	Silver flowering stage	3.232
	SRR8316905	Silver flowering stage	1.436
	SRR8316906	Gold flowering stage	5.185
	SRR8316907	Gold flowering stage	4.285
	SRR8316908	Gold flowering stage	4.148
SRP132670	SRR6706286	Control	9.989
	SRR6706287	Light intensity 50%	8.658
	SRR6706288	Light intensity 20%	9.877
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.496
	CNS0095593	Slightly white alabastrum(diploid) 2	8.073
	CNS0095594	Slightly white alabastrum(diploid) 3	6.098
	CNS0095595	Whole white alabastrum(diploid) 2	3.780
	CNS0095596	Whole white alabastrum(diploid) 3	6.586
	CNS0095597	Whole white alabastrum(diploid) 4	4.621
	CNS0095598	Silvery flower (diploied) 1	6.532
	CNS0095599	Silvery flower (diploied) 2	3.502
	CNS0095600	Silvery flower (diploied) 3	5.313
	CNS0095601	Golden flower (diploid) 1	4.810
	CNS0095602	Golden flower (diploid) 2	3.223
	CNS0095603	Golden flower (diploid) 3	3.643
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.543
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.502
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.571
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.626
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.588
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.151
	CNS0095610	Silvery flower (tetraploid) 1	0.919
	CNS0095611	Silvery flower (tetraploid) 2	1.010
	CNS0095612	Silvery flower (tetraploid) 3	0.931
	CNS0095613	Golden flower (tetraploid) 1	0.600
	CNS0095614	Golden flower (tetraploid) 2	1.674
	CNS0095615	Golden flower (tetraploid) 3	1.246
CRA001975	CRR073297	Stem 1	15.723
	CRR073298	Stem 2	12.645
	CRR073299	Stem 3	13.646
	CRR073300	Leaf 1	15.809
	CRR073301	Leaf 2	10.446
	CRR073302	Leaf 3	13.912
	CRR073303	Juvenile bud 1	14.063
	CRR073304	Juvenile bud 2	11.440
	CRR073305	Juvenile bud 3	11.939
	CRR073306	Third green 1	3.206
	CRR073307	Third green 2	3.743
	CRR073308	Third green 3	2.669
	CRR073309	Second white 1	1.905
	CRR073310	Second white 2	4.483
	CRR073311	Second white 3	4.074
	CRR073312	Silver flowering 1	2.018
	CRR073313	Silver flowering 2	1.139
	CRR073314	Silver flowering 3	1.909
	CRR073315	Gold flowering 1	6.362
	CRR073316	Gold flowering 2	11.203
	CRR073317	Gold flowering 3	4.684
	CRR073318	Tawny withering 1	14.961
	CRR073319	Tawny withering 2	12.089
	CRR073320	Tawny withering 3	12.604