Gene detail

Detail information of GWHGAAZE023472

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008392865.1	7.86296E-94	PREDICTED: 60S ribosomal protein L26-1 [Malus domestica]
COG	NP_579542.1	3E-27	50S ribosomal protein L24
Swissprot	tr\|P51414\|RL261_ARATH	3E-89	60S ribosomal protein L26-1
trEMBL	tr\|W9RS71\|W9RS71_9ROSA	5E-94	60S ribosomal protein L26-1 {ECO:0000313\|EMBL:EXB94051.1}
TAIR10	AT3G49910.1	1E-52	Translation protein SH3-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	9602338	9602760	-
GWHAAZE00000007	mRNA	9602338	9602760	-
GWHAAZE00000007	exon	9602338	9602760	-
GWHAAZE00000007	CDS	9602338	9602760	-

Transcript Sequence
>GWHTAAZE023502 ATGAAGTACAATCCTAGGGTTACGAGCTCCCGCCGGAAGAACAGGAAGGCCCACTTCTCGGCCCCATCCAGCGTCCGTCGCGTCCTCATGAGCGCCCCACTCTCAGGCGACCTCCGGTCCAAGTACAACGTCCGGTCGATGCCGGTCCGCAAGGACGACGAGGTGCAGGTTGTTCGTGGGACCTACAAGGGCCGCGAGGGAAAAGTTGTCCAAGTTTACCGCCGGAAATGGGTGATTCACATCGAACGAATCACAAGAGAGAAGGTGAATGGATCCACTGTCAATGTTGGAATTAATCCTTCGAAGGTTTTGATAACTAAGCTCAGACTTGATAAAGATCGTAAGTCTCTGCTTGATCGTAAGGCTAAGGGTCGTGCTGCGGCGGATAAGGATAAGGGGACTAAGTTTACTGCTGAGGATATT

Network for GWHGAAZE023472

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16906.6	Ribosomal_L26	8	121	2.50E-37
PF00467.30	KOW	51	82	2.80E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02898	RP-L26e, RPL26	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015934	cellular_component	large ribosomal subunit
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	204.025
	SRR3591706	second leaf	80.857
	SRR3591707	mature leaf	43.350
	SRR3591708	Shoot apex	251.537
	SRR3591709	Stem	141.553
	SRR3591710	White floral bud	101.960
	SRR3591711	White flower	132.162
	SRR3591712	Green floral bud	235.898
	SRR3591713	Yellow flower	89.099
SRP173429	SRR8316895	Juvenile bud stage	136.277
	SRR8316896	Juvenile bud stage	186.231
	SRR8316897	Juvenile bud stage	77.370
	SRR8316894	Third green stage	66.514
	SRR8316900	Third green stage	211.463
	SRR8316901	Third green stage	224.630
	SRR8316898	Complete white stage	29.953
	SRR8316899	Complete white stage	205.020
	SRR8316903	Complete white stage	49.815
	SRR8316902	Silver flowering stage	36.780
	SRR8316904	Silver flowering stage	36.597
	SRR8316905	Silver flowering stage	23.187
	SRR8316906	Gold flowering stage	56.864
	SRR8316907	Gold flowering stage	62.351
	SRR8316908	Gold flowering stage	89.833
SRP132670	SRR6706286	Control	183.747
	SRR6706287	Light intensity 50%	186.502
	SRR6706288	Light intensity 20%	203.410
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	193.824
	CNS0095593	Slightly white alabastrum(diploid) 2	213.376
	CNS0095594	Slightly white alabastrum(diploid) 3	197.778
	CNS0095595	Whole white alabastrum(diploid) 2	139.331
	CNS0095596	Whole white alabastrum(diploid) 3	168.802
	CNS0095597	Whole white alabastrum(diploid) 4	143.010
	CNS0095598	Silvery flower (diploied) 1	119.106
	CNS0095599	Silvery flower (diploied) 2	101.193
	CNS0095600	Silvery flower (diploied) 3	74.855
	CNS0095601	Golden flower (diploid) 1	106.258
	CNS0095602	Golden flower (diploid) 2	89.384
	CNS0095603	Golden flower (diploid) 3	81.395
	CNS0095604	Slightly white alabastrum(tetraploid) 1	164.673
	CNS0095605	Slightly white alabastrum(tetraploid) 2	149.425
	CNS0095606	Slightly white alabastrum(tetraploid) 3	258.614
	CNS0095607	Whole white alabastrum(tetraploid) 1	83.465
	CNS0095608	Whole white alabastrum(tetraploid) 2	84.429
	CNS0095609	Whole white alabastrum(tetraploid) 3	176.573
	CNS0095610	Silvery flower (tetraploid) 1	79.473
	CNS0095611	Silvery flower (tetraploid) 2	54.641
	CNS0095612	Silvery flower (tetraploid) 3	35.533
	CNS0095613	Golden flower (tetraploid) 1	39.792
	CNS0095614	Golden flower (tetraploid) 2	64.302
	CNS0095615	Golden flower (tetraploid) 3	37.443
CRA001975	CRR073297	Stem 1	219.338
	CRR073298	Stem 2	232.903
	CRR073299	Stem 3	268.473
	CRR073300	Leaf 1	250.612
	CRR073301	Leaf 2	254.869
	CRR073302	Leaf 3	348.247
	CRR073303	Juvenile bud 1	274.896
	CRR073304	Juvenile bud 2	210.617
	CRR073305	Juvenile bud 3	225.258
	CRR073306	Third green 1	26.174
	CRR073307	Third green 2	36.194
	CRR073308	Third green 3	33.990
	CRR073309	Second white 1	28.656
	CRR073310	Second white 2	29.112
	CRR073311	Second white 3	18.670
	CRR073312	Silver flowering 1	25.798
	CRR073313	Silver flowering 2	49.986
	CRR073314	Silver flowering 3	23.633
	CRR073315	Gold flowering 1	111.077
	CRR073316	Gold flowering 2	110.776
	CRR073317	Gold flowering 3	122.373
	CRR073318	Tawny withering 1	220.903
	CRR073319	Tawny withering 2	160.387
	CRR073320	Tawny withering 3	203.374