Gene detail

Detail information of GWHGAAZE023482

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004300093.1	9.94292E-44	PREDICTED: 50S ribosomal protein L7/L12-like isoform 1 [Fragaria vesca subsp. vesca]
COG	YP_004882520.1	9E-13	50S ribosomal protein L7/L12
Swissprot	tr\|O78414\|RK12_GUITH	2E-14	50S ribosomal protein L12, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00368}
trEMBL	tr\|M5VI87\|M5VI87_PRUPE	3E-42	Uncharacterized protein {ECO:0000313\|EMBL:EMJ00834.1}
TAIR10	AT4G37660.1	1E-16	Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	9904877	9905188	+
GWHAAZE00000007	mRNA	9904877	9905188	+
GWHAAZE00000007	exon	9904877	9905188	+
GWHAAZE00000007	CDS	9904877	9905188	+

Transcript Sequence
>GWHTAAZE023512 ATGGGCTTCAACAAGTACGGACCCGCAGTTTCCGGCCTAGAGTCGGCGCAGGGATCCGCCGGAGCAGGCGCCGGAGCTGGAGAGGCGAAGGCGGAGAAGACGGTGTTCGATATAAAGCTGGAGAAATTCGATGCGGCGGCGAAGATTAAGGTGATTAAGGAAGTTAGGTCTTTTACGGATTTAGGGTTGAAGGATGCAAAGGATTTGGTGGAGAAAGCTCCGGTTGTGGTGAAGAAAGGGGTTACTAAGGAAGAAGGGGCTTCCATTATCGACAAATTGAAGGAATTGGGAGCTATTGTGGTATTGGAGTGA

Network for GWHGAAZE023482

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00542.20	Ribosomal_L12	36	102	6.30E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02935	RP-L7, MRPL12, rplL	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.731
	SRR3591706	second leaf	32.454
	SRR3591707	mature leaf	44.990
	SRR3591708	Shoot apex	49.197
	SRR3591709	Stem	46.819
	SRR3591710	White floral bud	52.984
	SRR3591711	White flower	59.330
	SRR3591712	Green floral bud	77.250
	SRR3591713	Yellow flower	53.287
SRP173429	SRR8316895	Juvenile bud stage	33.743
	SRR8316896	Juvenile bud stage	58.245
	SRR8316897	Juvenile bud stage	22.323
	SRR8316894	Third green stage	20.637
	SRR8316900	Third green stage	58.480
	SRR8316901	Third green stage	68.861
	SRR8316898	Complete white stage	13.819
	SRR8316899	Complete white stage	46.062
	SRR8316903	Complete white stage	27.570
	SRR8316902	Silver flowering stage	16.281
	SRR8316904	Silver flowering stage	19.405
	SRR8316905	Silver flowering stage	12.437
	SRR8316906	Gold flowering stage	30.190
	SRR8316907	Gold flowering stage	29.236
	SRR8316908	Gold flowering stage	33.283
SRP132670	SRR6706286	Control	64.617
	SRR6706287	Light intensity 50%	58.282
	SRR6706288	Light intensity 20%	58.569
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	82.864
	CNS0095593	Slightly white alabastrum(diploid) 2	90.400
	CNS0095594	Slightly white alabastrum(diploid) 3	105.519
	CNS0095595	Whole white alabastrum(diploid) 2	73.200
	CNS0095596	Whole white alabastrum(diploid) 3	80.811
	CNS0095597	Whole white alabastrum(diploid) 4	74.535
	CNS0095598	Silvery flower (diploied) 1	40.690
	CNS0095599	Silvery flower (diploied) 2	35.196
	CNS0095600	Silvery flower (diploied) 3	32.177
	CNS0095601	Golden flower (diploid) 1	36.105
	CNS0095602	Golden flower (diploid) 2	23.632
	CNS0095603	Golden flower (diploid) 3	29.003
	CNS0095604	Slightly white alabastrum(tetraploid) 1	81.881
	CNS0095605	Slightly white alabastrum(tetraploid) 2	96.216
	CNS0095606	Slightly white alabastrum(tetraploid) 3	62.507
	CNS0095607	Whole white alabastrum(tetraploid) 1	66.701
	CNS0095608	Whole white alabastrum(tetraploid) 2	54.937
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.159
	CNS0095610	Silvery flower (tetraploid) 1	33.558
	CNS0095611	Silvery flower (tetraploid) 2	31.281
	CNS0095612	Silvery flower (tetraploid) 3	36.401
	CNS0095613	Golden flower (tetraploid) 1	36.916
	CNS0095614	Golden flower (tetraploid) 2	39.362
	CNS0095615	Golden flower (tetraploid) 3	26.218
CRA001975	CRR073297	Stem 1	56.356
	CRR073298	Stem 2	50.692
	CRR073299	Stem 3	54.034
	CRR073300	Leaf 1	58.310
	CRR073301	Leaf 2	54.636
	CRR073302	Leaf 3	84.323
	CRR073303	Juvenile bud 1	67.938
	CRR073304	Juvenile bud 2	76.289
	CRR073305	Juvenile bud 3	52.276
	CRR073306	Third green 1	35.400
	CRR073307	Third green 2	53.254
	CRR073308	Third green 3	41.599
	CRR073309	Second white 1	57.926
	CRR073310	Second white 2	53.007
	CRR073311	Second white 3	26.140
	CRR073312	Silver flowering 1	38.905
	CRR073313	Silver flowering 2	42.694
	CRR073314	Silver flowering 3	37.852
	CRR073315	Gold flowering 1	62.829
	CRR073316	Gold flowering 2	59.944
	CRR073317	Gold flowering 3	56.801
	CRR073318	Tawny withering 1	48.344
	CRR073319	Tawny withering 2	53.820
	CRR073320	Tawny withering 3	71.093