Gene detail

Detail information of GWHGAAZE023763

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP09362.1	2.87489E-08	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9T034\|SYFA_ARATH	0.00000002	Probable phenylalanine--tRNA ligase alpha subunit
trEMBL	tr\|A0A068UM40\|A0A068UM40_COFCA	0.00000001	Coffea canephora DH200=94 genomic scaffold, scaffold_38 {ECO:0000313\|EMBL:CDP09362.1}
TAIR10	AT4G39280.2	0.0000006	phenylalanyl-tRNA synthetase, putative / phenylalanine--tRNA ligase, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	25294785	25295127	+
GWHAAZE00000007	mRNA	25294785	25295127	+
GWHAAZE00000007	exon	25294785	25294817	+
GWHAAZE00000007	exon	25294908	25294945	+
GWHAAZE00000007	exon	25295079	25295127	+
GWHAAZE00000007	CDS	25294785	25294817	+
GWHAAZE00000007	CDS	25294908	25294945	+
GWHAAZE00000007	CDS	25295079	25295127	+

Transcript Sequence
>GWHTAAZE023793 ATGGATATGGCAAATATGATAACTGCTACAGCGGTACGAAGGCAAATGCAGATGATTTTTCTTCAGATGGGATTCGAGGAGATGCCAACAAACAATTATGTTGAAAGCAGGTACAAATGA

Network for GWHGAAZE023763

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01889	FARSA, pheS	Aminoacyl-tRNA biosynthesis	map00970

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.074
	SRR3591706	second leaf	4.663
	SRR3591707	mature leaf	2.403
	SRR3591708	Shoot apex	5.477
	SRR3591709	Stem	10.244
	SRR3591710	White floral bud	4.067
	SRR3591711	White flower	6.243
	SRR3591712	Green floral bud	2.610
	SRR3591713	Yellow flower	2.898
SRP173429	SRR8316895	Juvenile bud stage	4.674
	SRR8316896	Juvenile bud stage	15.147
	SRR8316897	Juvenile bud stage	9.351
	SRR8316894	Third green stage	2.768
	SRR8316900	Third green stage	8.761
	SRR8316901	Third green stage	9.475
	SRR8316898	Complete white stage	1.862
	SRR8316899	Complete white stage	10.955
	SRR8316903	Complete white stage	4.123
	SRR8316902	Silver flowering stage	1.728
	SRR8316904	Silver flowering stage	2.333
	SRR8316905	Silver flowering stage	0.160
	SRR8316906	Gold flowering stage	5.998
	SRR8316907	Gold flowering stage	0.898
	SRR8316908	Gold flowering stage	8.670
SRP132670	SRR6706286	Control	5.198
	SRR6706287	Light intensity 50%	4.933
	SRR6706288	Light intensity 20%	7.012
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.905
	CNS0095593	Slightly white alabastrum(diploid) 2	8.450
	CNS0095594	Slightly white alabastrum(diploid) 3	11.827
	CNS0095595	Whole white alabastrum(diploid) 2	6.721
	CNS0095596	Whole white alabastrum(diploid) 3	10.816
	CNS0095597	Whole white alabastrum(diploid) 4	8.796
	CNS0095598	Silvery flower (diploied) 1	5.022
	CNS0095599	Silvery flower (diploied) 2	4.904
	CNS0095600	Silvery flower (diploied) 3	10.808
	CNS0095601	Golden flower (diploid) 1	8.203
	CNS0095602	Golden flower (diploid) 2	7.698
	CNS0095603	Golden flower (diploid) 3	8.320
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.339
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.802
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.891
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.441
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.277
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.262
	CNS0095610	Silvery flower (tetraploid) 1	13.495
	CNS0095611	Silvery flower (tetraploid) 2	14.919
	CNS0095612	Silvery flower (tetraploid) 3	10.995
	CNS0095613	Golden flower (tetraploid) 1	4.250
	CNS0095614	Golden flower (tetraploid) 2	6.666
	CNS0095615	Golden flower (tetraploid) 3	5.239
CRA001975	CRR073297	Stem 1	10.945
	CRR073298	Stem 2	14.304
	CRR073299	Stem 3	9.551
	CRR073300	Leaf 1	12.595
	CRR073301	Leaf 2	7.369
	CRR073302	Leaf 3	13.291
	CRR073303	Juvenile bud 1	11.869
	CRR073304	Juvenile bud 2	2.040
	CRR073305	Juvenile bud 3	6.348
	CRR073306	Third green 1	1.073
	CRR073307	Third green 2	0.135
	CRR073308	Third green 3	0.389
	CRR073309	Second white 1	0.218
	CRR073310	Second white 2	0.405
	CRR073311	Second white 3	0.131
	CRR073312	Silver flowering 1	0.261
	CRR073313	Silver flowering 2	0.234
	CRR073314	Silver flowering 3	0.834
	CRR073315	Gold flowering 1	1.462
	CRR073316	Gold flowering 2	1.306
	CRR073317	Gold flowering 3	0.279
	CRR073318	Tawny withering 1	9.972
	CRR073319	Tawny withering 2	2.531
	CRR073320	Tawny withering 3	5.838