Gene detail

Detail information of GWHGAAZE023766

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009592441.1	2.21512E-27	PREDICTED: uncharacterized protein LOC104089292 [Nicotiana tomentosiformis]
trEMBL	tr\|O65713\|O65713_ARATH	1E-27	Putative pectinacetylesterase {ECO:0000313\|EMBL:CAA18629.1}
TAIR10	AT4G19410.2	3E-22	Pectinacetylesterase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	25346375	25348208	+
GWHAAZE00000007	mRNA	25346375	25348208	+
GWHAAZE00000007	exon	25346375	25346392	+
GWHAAZE00000007	exon	25346502	25346626	+
GWHAAZE00000007	exon	25346717	25346798	+
GWHAAZE00000007	exon	25346940	25346993	+
GWHAAZE00000007	exon	25348035	25348208	+
GWHAAZE00000007	CDS	25346375	25346392	+
GWHAAZE00000007	CDS	25346502	25346626	+
GWHAAZE00000007	CDS	25346717	25346798	+
GWHAAZE00000007	CDS	25346940	25346993	+
GWHAAZE00000007	CDS	25348035	25348208	+

Transcript Sequence
>GWHTAAZE023796 ATGAGTGAAGCATCAAATGTGCTTCTCTCGGGAAACTCTGCAGGTGGTTTAGCTTCGATACTACACTGCGATAGATTCCGAGCATTTCTACCCGTCACTGCTAGAGTGAAATGCTTTTCAGATGGCGGATATTTTATTCACGCTGCAATGTGCTTTAACTGGAGAGATATTTCTGGGAAATATCACTTCGAAGAAGTCATGTTTGATAGGGTGGTTTGCTTACATGGATCAATCAAGAATTTGCCTCGGGCGTGCACTTCCAAGATGAAACGAGGCTTGACTCTTAATAGATTTTCGTTTTGCTTTGCAATCAATTTCAGAGGTGTTGGAGAGTGGTACTACGATAGAGGTGTTGTACAATTGATAGATCACCAAAATCGATGGCCACATGAATGTGTCTTGGATGAAGGAGAACCCAATCGTCAAAATAATTATATCGGGCGGGATAATTAA

Network for GWHGAAZE023766

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0263

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03283.14	PAE	1	91	1.80E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19882	NOTUM	Wnt signaling pathway	map04310

Gene Ontology

GO term	Ontology	Name
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.023
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.111
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.379
	SRR8316903	Complete white stage	0.203
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.010
SRP132670	SRR6706286	Control	0.197
	SRR6706287	Light intensity 50%	0.134
	SRR6706288	Light intensity 20%	0.092
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.410
	CNS0095593	Slightly white alabastrum(diploid) 2	0.027
	CNS0095594	Slightly white alabastrum(diploid) 3	0.058
	CNS0095595	Whole white alabastrum(diploid) 2	0.304
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.102
	CNS0095598	Silvery flower (diploied) 1	0.015
	CNS0095599	Silvery flower (diploied) 2	0.204
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.011
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.207
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.010
	CNS0095610	Silvery flower (tetraploid) 1	0.010
	CNS0095611	Silvery flower (tetraploid) 2	0.010
	CNS0095612	Silvery flower (tetraploid) 3	0.009
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.025
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000