Gene detail

Detail information of GWHGAAZE023891

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABM98114.1	5.02349E-13	glyceraldehyde-3-phosphate dehydrogenase [Pachycladon radicatum]
COG	YP_462743.1	1E-10	glyceraldehyde 3-phosphate dehydrogenase
Swissprot	tr\|P17878\|G3PC_MESCR	1E-14	Glyceraldehyde-3-phosphate dehydrogenase, cytosolic
trEMBL	tr\|A2T8U3\|A2T8U3_9BRAS	2E-13	Glyceraldehyde-3-phosphate dehydrogenase {ECO:0000313\|EMBL:ABM98114.1} (Fragment)
TAIR10	AT3G04120.1	1E-11	glyceraldehyde-3-phosphate dehydrogenase C subunit 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	28977460	28979479	+
GWHAAZE00000007	mRNA	28977460	28979479	+
GWHAAZE00000007	exon	28977460	28977719	+
GWHAAZE00000007	exon	28979347	28979479	+
GWHAAZE00000007	CDS	28977460	28977719	+
GWHAAZE00000007	CDS	28979347	28979479	+

Transcript Sequence
>GWHTAAZE023923 ATGAATACTCCATTTCTTCATCAAAATCATCCCTCAAATTTTCATCAACCAATATTTGGATCCGAGGCTTTATCGAACCATACTCGTTTCGATAATCAACTCATTGAGCTCCCACAACTGGATAGCCCCACGGTTTCAACAAGTTTAGCTACAAATGAAGATCTTGACCATGGGACGATAAATAATGCTAACCAGTACATTGGTTGGGAAAACTTGGATAACTTACTTTCATCAAAGAGGATTGAGCCAGCGTTATCCACAGGTGGAAGAGCTCCATCTTTCAACATCGTACCTAGTTGCACCGGAGCCGTCAAGGGTGTCGGTGAAGTGCTGCCAGCATTGAAAGGTAAATTCCCTGGAATGGCCTTCCGAGTTCCAAGATGTTTGAGTTGA

Network for GWHGAAZE023891

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02800.21	Gp_dh_C	88	126	3.70E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00134	GAPDH, gapA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Biosynthesis of amino acids	map01230
		Glycolysis / Gluconeogenesis	map00010
		Carbon fixation in photosynthetic organisms	map00710
		HIF-1 signaling pathway	map04066

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016620	molecular_function	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.007
	SRR3591706	second leaf	1.283
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.434
	SRR3591709	Stem	0.762
	SRR3591710	White floral bud	1.147
	SRR3591711	White flower	1.940
	SRR3591712	Green floral bud	0.577
	SRR3591713	Yellow flower	1.567
SRP173429	SRR8316895	Juvenile bud stage	0.117
	SRR8316896	Juvenile bud stage	0.271
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.216
	SRR8316900	Third green stage	0.155
	SRR8316901	Third green stage	0.147
	SRR8316898	Complete white stage	0.343
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.226
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.087
	SRR8316906	Gold flowering stage	0.605
	SRR8316907	Gold flowering stage	0.482
	SRR8316908	Gold flowering stage	0.186
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.040
	SRR6706288	Light intensity 20%	0.010
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.262
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.145
	CNS0095596	Whole white alabastrum(diploid) 3	0.072
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.118
	CNS0095599	Silvery flower (diploied) 2	0.754
	CNS0095600	Silvery flower (diploied) 3	0.018
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	1.109
	CNS0095603	Golden flower (diploid) 3	1.488
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.166
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.631
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.433
	CNS0095611	Silvery flower (tetraploid) 2	0.264
	CNS0095612	Silvery flower (tetraploid) 3	0.455
	CNS0095613	Golden flower (tetraploid) 1	0.265
	CNS0095614	Golden flower (tetraploid) 2	1.097
	CNS0095615	Golden flower (tetraploid) 3	0.222
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.567
	CRR073299	Stem 3	0.037
	CRR073300	Leaf 1	0.131
	CRR073301	Leaf 2	0.125
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.002
	CRR073309	Second white 1	0.212
	CRR073310	Second white 2	0.177
	CRR073311	Second white 3	0.008
	CRR073312	Silver flowering 1	0.001
	CRR073313	Silver flowering 2	1.174
	CRR073314	Silver flowering 3	0.182
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.021
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	1.083