Gene detail

Detail information of GWHGAAZE023967

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002285833.1	4.22301E-94	PREDICTED: 30S ribosomal protein S13, chloroplastic [Vitis vinifera]
COG	YP_008580866.1	3E-35	30S ribosomal protein S13
Swissprot	tr\|P42732\|RR13_ARATH	2E-79	30S ribosomal protein S13, chloroplastic (Precursor)
trEMBL	tr\|E0CRC2\|E0CRC2_VITVI	2E-94	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI19076.3}
TAIR10	AT5G14320.1	7E-63	Ribosomal protein S13/S18 family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	30858014	30861217	+
GWHAAZE00000007	mRNA	30858014	30861217	+
GWHAAZE00000007	exon	30858014	30858139	+
GWHAAZE00000007	exon	30858954	30859178	+
GWHAAZE00000007	exon	30861050	30861217	+
GWHAAZE00000007	CDS	30858014	30858139	+
GWHAAZE00000007	CDS	30858954	30859178	+
GWHAAZE00000007	CDS	30861050	30861217	+

Transcript Sequence
>GWHTAAZE023999 ATGGCTCAATCAGTAGCAACACCAATTCTACCTTCACTCTCTCTTATCTGCAACACCTCCTCCTTGTCCTCAATCCCTAAATCCCGCCCTAATTCTCTCTCTTTCCACACTTCAAACCCTCCCAAGTATGGTGGGTTGAGCATAAAATGTGCTCGTGTGGGAGGTGTGGAGATTCCAAATTCAAAGCGAGTGCAGTACTCTTTACAGTATATTCATGGAATCGGACGTACCAGAGCACTTCAAATACTGGGAGACCTTAAAATGGAGAACAAAATTACCAAGGATTTGTCAGAGGAAGAGCTTGTTATTCTCCGTGCGGAAGTCAACAAGTACATGATTGAGGGCGACCTTAGGCGATTCAATGCAGTTGCAATTAGAAGGTTGAAGGAGATTCAGTGCTATAGAGGGATACGGCACATTAAGGGGCTACCGTGCCGAGGTCAGCGAACCAAGAACAATTGCCGGACATTGAAGGGTAAGAAGGTGGCAATTGCAGGGAAGAAGAAGGCAGTTCGTTAA

Network for GWHGAAZE023967

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00416.23	Ribosomal_S13	52	156	1.60E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02952	RP-S13, rpsM	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	160.588
	SRR3591706	second leaf	352.633
	SRR3591707	mature leaf	220.949
	SRR3591708	Shoot apex	340.735
	SRR3591709	Stem	79.713
	SRR3591710	White floral bud	93.194
	SRR3591711	White flower	89.733
	SRR3591712	Green floral bud	133.737
	SRR3591713	Yellow flower	101.136
SRP173429	SRR8316895	Juvenile bud stage	82.781
	SRR8316896	Juvenile bud stage	80.158
	SRR8316897	Juvenile bud stage	66.724
	SRR8316894	Third green stage	43.972
	SRR8316900	Third green stage	158.605
	SRR8316901	Third green stage	128.826
	SRR8316898	Complete white stage	41.812
	SRR8316899	Complete white stage	109.217
	SRR8316903	Complete white stage	59.837
	SRR8316902	Silver flowering stage	43.741
	SRR8316904	Silver flowering stage	51.106
	SRR8316905	Silver flowering stage	26.893
	SRR8316906	Gold flowering stage	96.889
	SRR8316907	Gold flowering stage	111.045
	SRR8316908	Gold flowering stage	95.315
SRP132670	SRR6706286	Control	179.434
	SRR6706287	Light intensity 50%	197.541
	SRR6706288	Light intensity 20%	223.183
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	109.743
	CNS0095593	Slightly white alabastrum(diploid) 2	95.722
	CNS0095594	Slightly white alabastrum(diploid) 3	87.480
	CNS0095595	Whole white alabastrum(diploid) 2	111.083
	CNS0095596	Whole white alabastrum(diploid) 3	124.893
	CNS0095597	Whole white alabastrum(diploid) 4	105.436
	CNS0095598	Silvery flower (diploied) 1	115.386
	CNS0095599	Silvery flower (diploied) 2	119.825
	CNS0095600	Silvery flower (diploied) 3	99.775
	CNS0095601	Golden flower (diploid) 1	103.384
	CNS0095602	Golden flower (diploid) 2	105.634
	CNS0095603	Golden flower (diploid) 3	108.069
	CNS0095604	Slightly white alabastrum(tetraploid) 1	128.515
	CNS0095605	Slightly white alabastrum(tetraploid) 2	131.624
	CNS0095606	Slightly white alabastrum(tetraploid) 3	141.316
	CNS0095607	Whole white alabastrum(tetraploid) 1	72.505
	CNS0095608	Whole white alabastrum(tetraploid) 2	100.851
	CNS0095609	Whole white alabastrum(tetraploid) 3	154.501
	CNS0095610	Silvery flower (tetraploid) 1	109.015
	CNS0095611	Silvery flower (tetraploid) 2	151.026
	CNS0095612	Silvery flower (tetraploid) 3	119.941
	CNS0095613	Golden flower (tetraploid) 1	109.345
	CNS0095614	Golden flower (tetraploid) 2	104.508
	CNS0095615	Golden flower (tetraploid) 3	67.916
CRA001975	CRR073297	Stem 1	144.932
	CRR073298	Stem 2	133.324
	CRR073299	Stem 3	167.581
	CRR073300	Leaf 1	97.584
	CRR073301	Leaf 2	104.112
	CRR073302	Leaf 3	181.979
	CRR073303	Juvenile bud 1	137.435
	CRR073304	Juvenile bud 2	185.674
	CRR073305	Juvenile bud 3	89.822
	CRR073306	Third green 1	91.824
	CRR073307	Third green 2	83.809
	CRR073308	Third green 3	68.931
	CRR073309	Second white 1	170.103
	CRR073310	Second white 2	94.507
	CRR073311	Second white 3	65.106
	CRR073312	Silver flowering 1	84.999
	CRR073313	Silver flowering 2	109.824
	CRR073314	Silver flowering 3	74.938
	CRR073315	Gold flowering 1	481.467
	CRR073316	Gold flowering 2	446.113
	CRR073317	Gold flowering 3	423.961
	CRR073318	Tawny withering 1	60.710
	CRR073319	Tawny withering 2	65.833
	CRR073320	Tawny withering 3	61.347