Gene detail

Detail information of GWHGAAZE024000

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12437.1	2.77731E-16	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q7XJS0\|ASHR1_ARATH	5E-15	Histone-lysine N-methyltransferase ASHR1
trEMBL	tr\|K7KM89\|K7KM89_SOYBN	8E-17	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA04G43200.2}
TAIR10	AT2G17900.1	6E-13	SET domain group 37

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	32354812	32356503	+
GWHAAZE00000007	mRNA	32354812	32356503	+
GWHAAZE00000007	exon	32354812	32354816	+
GWHAAZE00000007	exon	32355342	32355383	+
GWHAAZE00000007	exon	32356344	32356503	+
GWHAAZE00000007	CDS	32354812	32354816	+
GWHAAZE00000007	CDS	32355342	32355383	+
GWHAAZE00000007	CDS	32356344	32356503	+

Transcript Sequence
>GWHTAAZE024032 ATGCAGAGTATATCCAGGATTCCGTCCTTTGCTTGGACTGCAATATTGTTCCTCGGAAACACGAAGGAAGCAATCGAATCACTTGCAAAGGCGGCTGATATATTACGGATTACACACGGAACAAGAACTACTTTCATGAAGGACCTCTTCGTCAAGCTCGAGGAAGCTCGCACTGAAGCTTCTTACAAGCCCTCATCTATGCACTAA

Network for GWHGAAZE024000

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11426	SMYD	Metabolic pathways	map01100
K11426	SMYD	Lysine degradation	map00310

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.072
	SRR3591706	second leaf	0.040
	SRR3591707	mature leaf	0.064
	SRR3591708	Shoot apex	0.165
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.881
	SRR3591711	White flower	1.667
	SRR3591712	Green floral bud	2.143
	SRR3591713	Yellow flower	1.201
SRP173429	SRR8316895	Juvenile bud stage	1.950
	SRR8316896	Juvenile bud stage	2.609
	SRR8316897	Juvenile bud stage	2.267
	SRR8316894	Third green stage	0.693
	SRR8316900	Third green stage	1.392
	SRR8316901	Third green stage	2.720
	SRR8316898	Complete white stage	1.238
	SRR8316899	Complete white stage	6.423
	SRR8316903	Complete white stage	1.802
	SRR8316902	Silver flowering stage	2.083
	SRR8316904	Silver flowering stage	2.764
	SRR8316905	Silver flowering stage	0.774
	SRR8316906	Gold flowering stage	3.893
	SRR8316907	Gold flowering stage	1.200
	SRR8316908	Gold flowering stage	4.890
SRP132670	SRR6706286	Control	1.196
	SRR6706287	Light intensity 50%	1.428
	SRR6706288	Light intensity 20%	1.926
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.541
	CNS0095593	Slightly white alabastrum(diploid) 2	3.113
	CNS0095594	Slightly white alabastrum(diploid) 3	2.739
	CNS0095595	Whole white alabastrum(diploid) 2	1.924
	CNS0095596	Whole white alabastrum(diploid) 3	2.424
	CNS0095597	Whole white alabastrum(diploid) 4	3.089
	CNS0095598	Silvery flower (diploied) 1	4.254
	CNS0095599	Silvery flower (diploied) 2	2.704
	CNS0095600	Silvery flower (diploied) 3	2.961
	CNS0095601	Golden flower (diploid) 1	3.230
	CNS0095602	Golden flower (diploid) 2	1.528
	CNS0095603	Golden flower (diploid) 3	2.322
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.604
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.264
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.985
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.753
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.461
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.969
	CNS0095610	Silvery flower (tetraploid) 1	4.038
	CNS0095611	Silvery flower (tetraploid) 2	1.483
	CNS0095612	Silvery flower (tetraploid) 3	1.430
	CNS0095613	Golden flower (tetraploid) 1	0.355
	CNS0095614	Golden flower (tetraploid) 2	2.173
	CNS0095615	Golden flower (tetraploid) 3	0.478
CRA001975	CRR073297	Stem 1	0.829
	CRR073298	Stem 2	1.493
	CRR073299	Stem 3	0.821
	CRR073300	Leaf 1	2.174
	CRR073301	Leaf 2	2.066
	CRR073302	Leaf 3	1.153
	CRR073303	Juvenile bud 1	1.773
	CRR073304	Juvenile bud 2	0.768
	CRR073305	Juvenile bud 3	0.654
	CRR073306	Third green 1	0.975
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.222
	CRR073309	Second white 1	0.161
	CRR073310	Second white 2	0.650
	CRR073311	Second white 3	0.726
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.205
	CRR073315	Gold flowering 1	0.134
	CRR073316	Gold flowering 2	0.466
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	3.211
	CRR073319	Tawny withering 2	3.998
	CRR073320	Tawny withering 3	1.096